DUSP7 (NM_001947) Human Untagged Clone

CAT#: SC327842

DUSP7 (untagged)-Human dual specificity phosphatase 7 (DUSP7)


  "NM_001947" in other vectors (5)

Reconstitution Protocol

USD 710.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DUSP7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DUSP7
Synonyms MKPX; PYST2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001947, the custom clone sequence may differ by one or more nucleotides


ATGAAAAACCAGCTCCGCGGCCCCCCAGCGCGGGCGCACATGTCGACTTCGGGGGCGGCGGCGGCTGGGG
GCACCCGGGCGGGGTCCGAGCCCGGTGCGGGGTCGGGGTCCGGCGCAGGCACCGGGGCGGGCGCGGCGAC
GGGGGCAGGGGCCATGCCCTGCAAGAGCGCCGAGTGGCTGCAGGAGGAGCTGGAGGCGCGCGGCGGCGCG
TCCTTGCTGCTGCTCGACTGCCGGCCGCACGAGCTCTTCGAGTCGTCGCACATCGAGACGGCCATCAACC
TGGCCATCCCGGGCCTCATGTTGCGCCGCCTGCGCAAGGGCAACCTGCCCATCCGCTCCATCATCCCCAA
CCACGCCGACAAGGAGCGCTTCGCCACGCGCTGCAAGGCGGCCACCGTGCTGCTCTACGACGAGGCCACG
GCCGAGTGGCAGCCCGAGCCCGGCGCTCCCGCCTCCGTGCTCGGCCTGCTCCTACAGAAGCTGCGCGACG
ACGGCTGCCAGGCCTACTACCTCCAAGGTGGTTTCAACAAGTTTCAAACAGAGTACTCTGAGCACTGCGA
GACCAACGTGGACAGCTCTTCCTCGCCGAGCAGCTCGCCACCCACCTCAGTGCTGGGCCTGGGGGGCCTG
CGCATCAGCTCTGACTGCTCCGACGGCGAGTCGGACCGAGAGCTGCCCAGCAGTGCCACCGAGTCAGACG
GCAGCCCTGTGCCATCCAGCCAACCAGCCTTCCCTGTCCAGATCCTGCCCTACCTCTACCTCGGCTGCGC
CAAGGACTCCACCAACCTGGACGTGCTCGGCAAGTATGGCATCAAGTATATCCTCAATGTCACACCCAAC
CTACCCAACGCCTTCGAGCACGGCGGCGAGTTCACCTACAAGCAGATCCCCATCTCTGACCACTGGAGCC
AGAACCTCTCCCAGTTCTTCCCTGAGGCCATCAGCTTCATTGACGAAGCCCGCTCCAAGAAGTGTGGTGT
CCTGGTGCACTGCCTGGCAGGCATCAGCCGCTCAGTGACGGTCACTGTGGCCTATCTGATGCAGAAGATG
AACCTGTCACTCAACGACGCCTACGACTTTGTCAAGAGGAAAAAGTCCAACATCTCGCCCAACTTCAACT
TCATGGGGCAGCTGCTGGACTTTGAGCGGACGCTGGGGCTAAGCAGCCCGTGCGACAACCACGCGTCGAG
TGAGCAGCTCTACTTTTCCACGCCCACCAACCACAACCTGTTCCCACTCAATACGCTGGAGTCCACGTGA


Restriction Sites SgfI-NotI     
ACCN NM_001947
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001947.3, NP_001938.2
RefSeq Size 3248 bp
RefSeq ORF 1260 bp
Locus ID 1849
Cytogenetics 3p21.2
Protein Families Druggable Genome, Phosphatase
Protein Pathways MAPK signaling pathway
Gene Summary 'Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. DUSP7 belongs to a class of DUSPs, designated MKPs, that dephosphorylate MAPK (mitogen-activated protein kinase) proteins ERK (see MIM 601795), JNK (see MIM 601158), and p38 (see MIM 600289) with specificity distinct from that of individual MKP proteins. MKPs contain a highly conserved C-terminal catalytic domain and an N-terminal Cdc25 (see MIM 116947)-like (CH2) domain. MAPK activation cascades mediate various physiologic processes, including cellular proliferation, apoptosis, differentiation, and stress responses (summary by Patterson et al., 2009 [PubMed 19228121]).[supplied by OMIM, Dec 2009]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.