Caspase 5 (CASP5) (NM_004347) Human Untagged Clone

CAT#: SC327856

CASP5 (untagged)-Human caspase 5 apoptosis-related cysteine peptidase (CASP5) transcript variant a


  "NM_004347" in other vectors (9)

Reconstitution Protocol

USD 730.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CASP5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CASP5
Synonyms ICE(rel)III; ICEREL-III; ICH-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_004347, the custom clone sequence may differ by one or more nucleotides


ATGGCTGAAGACAGTGGCAAAAAAAAAAGGCGTAAGAATTTTGAAGCTATGTTCAAAGGTATCCTTCAGA
GTGGATTGGATAACTTCGTGATAAACCACATGCTAAAGAACAACGTGGCTGGACAAACATCTATCCAGAC
CCTAGTACCTAATACGGATCAAAAGTCGACCAGTGTAAAAAAAGACAACCACAAAAAAAAAACAGTTAAG
ATGTTGGAATACCTGGGCAAAGATGTTCTTCATGGTGTTTTTAATTATTTGGCAAAACACGATGTTCTGA
CATTGAAGGAAGAGGAAAAGAAAAAATATTATGATACCAAAATTGAAGACAAGGCCCTGATCTTGGTAGA
CTCTTTGCGAAAGAATCGCGTGGCTCATCAAATGTTTACCCAAACACTTCTCAATATGGACCAAAAGATC
ACCAGTGTAAAACCTCTTCTGCAAATCGAGGCTGGACCACCTGAGTCAGCAGAATCTACAAATATACTCA
AACTTTGTCCTCGTGAAGAATTCCTGAGACTGTGTAAAAAAAATCATGATGAGATCTATCCAATAAAAAA
GAGAGAGGACCGCAGACGCCTGGCTCTCATCATATGCAATACAAAGTTTGATCACCTGCCTGCAAGGAAT
GGGGCTCACTATGACATCGTGGGGATGAAAAGGCTGCTTCAAGGCCTGGGCTACACTGTGGTTGACGAAA
AGAATCTCACAGCCAGGGATATGGAGTCAGTGCTGAGGGCATTTGCTGCCAGACCAGAGCACAAGTCCTC
TGACAGCACGTTCTTGGTACTCATGTCTCATGGCATCCTAGAGGGAATCTGCGGAACTGCGCATAAAAAG
AAAAAACCGGATGTGCTGCTTTATGACACCATCTTCCAGATATTCAACAACCGCAACTGCCTCAGTCTAA
AGGACAAACCCAAGGTCATCATTGTCCAGGCCTGCAGAGGTGAAAAACATGGGGAACTCTGGGTCAGAGA
CTCTCCAGCATCCTTGGCACTCATCTCTTCACAGTCATCTGAGAACCTGGAGGCAGATTCTGTTTGCAAG
ATCCACGAGGAGAAGGACTTCATTGCTTTCTGTTCTTCAACACCACATAACGTGTCCTGGAGAGACCGCA
CAAGGGGCTCCATCTTCATTACGGAACTCATCACATGCTTCCAGAAATATTCTTGCTGCTGCCACCTAAT
GGAAATATTTCGGAAGGTACAGAAATCATTTGAAGTTCCACAGGCTAAAGCCCAGATGCCCACCATAGAA
CGAGCAACCTTGACAAGAGATTTCTACCTCTTTCCTGGCAATTGA


Restriction Sites SgfI-MluI     
ACCN NM_004347
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004347.3, NP_004338.3
RefSeq Size 1449 bp
RefSeq ORF 1305 bp
Locus ID 838
Cytogenetics 11q22.3
Protein Families Druggable Genome, Protease
Protein Pathways NOD-like receptor signaling pathway
Gene Summary 'This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. Overexpression of the active form of this enzyme induces apoptosis in fibroblasts. Max, a central component of the Myc/Max/Mad transcription regulation network important for cell growth, differentiation, and apoptosis, is cleaved by this protein; this process requires Fas-mediated dephosphorylation of Max. The expression of this gene is regulated by interferon-gamma and lipopolysaccharide. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]'
Transcript Variant: This variant (a) encodes isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.