PPM1A (NM_177952) Human Untagged Clone

CAT#: SC327866

PPM1A (untagged)-Human protein phosphatase 1A (formerly 2C) magnesium-dependent alpha isoform (PPM1A) transcript variant 3


  "NM_177952" in other vectors (5)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PPM1A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPM1A
Synonyms PP2C-ALPHA; PP2CA; PP2Calpha
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_177952, the custom clone sequence may differ by one or more nucleotides


ATGTTCTGTTCTGGGAGAAAATGGGTAGCAGAAGCTACAATTTGTACTAAGCTAATGAAAAGAGAGAAAA
GAAGAATGGGGAAGAGAAGGGCAAAGAAGGCAAAAAGAGAAGAGAAGAAAAAGGGAGGAGAGAGAAGGAG
AAATGAGAAAAGAGGAAACCAAATGAAGAGGATGTGTGAGAGAAAAAAATATGAAACAGACCTAGAGGAT
CAAGACATAATGGGAGCATTTTTAGACAAGCCAAAGATGGAAAAGCATAATGCCCAGGGGCAGGGTAATG
GGTTGCGATATGGGCTAAGCAGCATGCAAGGCTGGCGTGTTGAAATGGAGGATGCACATACGGCTGTGAT
CGGTTTGCCAAGTGGACTTGAATCGTGGTCATTCTTTGCTGTGTATGATGGGCATGCTGGTTCTCAGGTT
GCCAAATACTGCTGTGAGCATTTGTTAGATCACATCACCAATAACCAGGATTTTAAAGGGTCTGCAGGAG
CACCTTCTGTGGAAAATGTAAAGAATGGAATCAGAACAGGTTTTCTGGAGATTGATGAACACATGAGAGT
TATGTCAGAGAAGAAACATGGTGCAGATAGAAGTGGGTCAACAGCTGTAGGTGTCTTAATTTCTCCCCAA
CATACTTATTTCATTAACTGTGGAGACTCAAGAGGTTTACTTTGTAGGAACAGGAAAGTTCATTTCTTCA
CACAAGATCACAAACCAAGTAATCCGCTGGAGAAAGAACGAATTCAGAATGCAGGTGGCTCTGTAATGAT
TCAGCGTGTGAATGGCTCTCTGGCTGTATCGAGGGCCCTTGGGGATTTTGATTACAAATGTGTCCATGGA
AAAGGTCCTACTGAGCAGCTTGTCTCACCAGAGCCTGAAGTCCATGATATTGAAAGATCTGAAGAAGATG
ATCAGTTCATTATCCTTGCATGTGATGGTATCTGGGATGTTATGGGAAATGAAGAGCTCTGTGATTTTGT
AAGATCCAGACTTGAAGTCACTGATGACCTTGAGAAAGTTTGCAATGAAGTAGTCGACACCTGTTTGTAT
AAGGGAAGTCGAGACAACATGAGTGTGATTTTGATCTGTTTTCCAAATGCACCCAAAGTATCGCCAGAAG
CAGTGAAGAAGGAGGCAGAGTTGGACAAGTACCTGGAATGCAGAGTAGAAGAAATCATAAAGAAGCAGGG
GGAAGGCGTCCCCGACTTAGTCCATGTGATGCGCACATTAGCGAGTGAGAACATCCCCAGCCTCCCACCA
GGGGGTGAATTGGCAAGCAAGAGGAATGTTATTGAAGCCGTTTACAATAGACTGAATCCTTACAAAAATG
ACGACACTGACTCTACATCAACAGATGATATGTGGTAA


Restriction Sites SgfI-MluI     
ACCN NM_177952
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_177952.2, NP_808821.2
RefSeq Size 8075 bp
RefSeq ORF 1368 bp
Locus ID 5494
Cytogenetics 14q23.1
Protein Families Druggable Genome, Phosphatase
Protein Pathways MAPK signaling pathway
Gene Summary 'The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase dephosphorylates, and negatively regulates the activities of, MAP kinases and MAP kinase kinases. It has been shown to inhibit the activation of p38 and JNK kinase cascades induced by environmental stresses. This phosphatase can also dephosphorylate cyclin-dependent kinases, and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to activate the expression of the tumor suppressor gene TP53/p53, which leads to G2/M cell cycle arrest and apoptosis. Three alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (3) has an alternate 5' exon, as compared to variant 1. It encodes isoform 3, which has a distinct and longer N-terminus, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.