FOXA2 (NM_021784) Human Untagged Clone

CAT#: SC327867

FOXA2 (untagged)-Human forkhead box A2 (FOXA2) transcript variant 1


  "NM_021784" in other vectors (7)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "FOXA2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FOXA2
Synonyms HNF3B; TCF3B
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene ORF sequence for NM_021784 edited
ATGCACTCGGCTTCCAGTATGCTGGGAGCGGTGAAGATGGAAGGGCACGAGCCGTCCGAC
TGGAGCAGCTACTATGCAGAGCCCGAGGGCTACTCCTCCGTGAGCAACATGAACGCCGGC
CTGGGGATGAACGGCATGAACACGTACATGAGCATGTCGGCGGCCGCCATGGGCAGCGGC
TCGGGCAACATGAGCGCGGGCTCCATGAACATGTCGTCGTACGTGGGCGCTGGCATGAGC
CCGTCCCTGGCGGGGATGTCCCCCGGCGCGGGCGCCATGGCGGGCATGGGCGGCTCGGCC
GGGGCGGCCGGCGTGGCGGGCATGGGGCCGCACTTGAGTCCCAGCCTGAGCCCGCTCGGG
GGGCAGGCGGCCGGGGCCATGGGCGGCCTGGCCCCCTACGCCAACATGAACTCCATGAGC
CCCATGTACGGGCAGGCGGGCCTGAGCCGCGCCCGCGACCCCAAGACCTACAGGCGCAGC
TACACGCACGCAAAGCCGCCCTACTCGTACATCTCGCTCATCACCATGGCCATCCAGCAG
AGCCCCAACAAGATGCTGACGCTGAGCGAGATCTACCAGTGGATCATGGACCTCTTCCCC
TTCTACCGGCAGAACCAGCAGCGCTGGCAGAACTCCATCCGCCACTCGCTCTCCTTCAAC
GACTGTTTCCTGAAGGTGCCCCGCTCGCCCGACAAGCCCGGCAAGGGCTCCTTCTGGACC
CTGCACCCTGACTCGGGCAACATGTTCGAGAACGGCTGCTACCTGCGCCGCCAGAAGCGC
TTCAAGTGCGAGAAGCAGCTGGCGCTGAAGGAGGCCGCAGGCGCCGCCGGCAGCGGCAAG
AAGGCGGCCGCCGGAGCCCAGGCCTCACAGGCTCAACTCGGGGAGGCCGCCGGGCCGGCC
TCCGAGACTCCGGCGGGCACCGAGTCGCCTCACTCGAGCGCCTCCCCGTGCCAGGAGCAC
AAGCGAGGGGGCCTGGGAGAGCTGAAGGGGACGCCGGCTGCGGCGCTGAGCCCCCCAGAG
CCGGCGCCCTCTCCCGGGCAGCAGCAGCAGGCCGCGGCCCACCTGCTGGGCCCGCCCCAC
CACCCGGGCCTGCCGCCTGAGGCCCACCTGAAGCCGGAACACCACTACGCCTTCAACCAC
CCGTTCTCCATCAACAACCTCATGTCCTCGGAGCAGCAGCACCACCACAGCCACCACCAC
CACCAACCCCACAAAATGGACCTCAAGGCCTACGAACAGGTGATGCACTACCCCGGCTAC
GGTTCCCCCATGCCTGGCAGCTTGGCCATGGGCCCGGTCACGAACAAAACGGGCCTGGAC
GCCTCGCCCCTGGCCGCAGATACCTCCTACTACCAGGGGGTGTACTCCCGGCCCATTATG
AACTCCTCTTAA
Restriction Sites Please inquire     
ACCN NM_021784
Insert Size 2428 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021784.4.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021784.4, NP_068556.2
RefSeq Size 2428 bp
RefSeq ORF 1392 bp
Locus ID 3170
Cytogenetics 20p11.21
Protein Families Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Transcription Factors
Protein Pathways Maturity onset diabetes of the young
Gene Summary 'This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific genes such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. This gene has been linked to sporadic cases of maturity-onset diabetes of the young. Transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]'
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.