FAM104B (NM_001166704) Human Untagged Clone

CAT#: SC328127

FAM104B (untagged)-Human family with sequence similarity 104 member B (FAM104B) transcript variant 7


  "NM_001166704" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "FAM104B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FAM104B
Synonyms CXorf44
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001166704, the custom clone sequence may differ by one or more nucleotides


ATGGGAGGCTGCCCTGTACGGAAAAGAAGAAGAAATGGCAGTAAAGAGGGCAACCATCATTCCACCCAGC
CCAAAAGGAATAAGAGAAACCCTATCTTTCAGGATTCTCAAGATACAGAGGTAGCAATTTTCATGGAGTG
A


Restriction Sites SgfI-MluI     
ACCN NM_001166704
ORF Size 141 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001166704.1, NP_001160176.1
RefSeq Size 1233
RefSeq ORF 141
Locus ID 90736
Gene Summary Belongs to the FAM104 family. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (7) uses an alternate splice site in the central coding region, and differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (7) has a distinct C-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.