PET100 (NM_001171155) Human Untagged Clone

CAT#: SC328135

PET100 (untagged)-Human similar to hCG2036585 (LOC100131801) transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PET100
• Synonyms: C19orf79
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001171155, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGGTGAAGCTGGAGATATTTCGGATGATAATCTACCTCACTTTCCCTGTGGCTATGTTCTGGGTTT
  CCAATCAGGCCGAGTGGTTTGAGGACGATGTCATACAGCGCAAGAGGGAGCTGTGGCCACCTGAGAAGCT
  TCAAGAGATAGAGGAATTCAAAGAGAGGTTACGGAAGCGGCGGGAGGAGAAGCTCCTTCGCGACGCCCAG
  CAGAACTCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001171155
• ORF Size: 222 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001171155.1, NP_001164626.1
• RefSeq Size: 349
• RefSeq ORF: 222
• Locus ID: 100131801
• Gene Summary: Mitochondrial complex IV, or cytochrome c oxidase, is a large transmembrane protein complex that is part of the respiratory electron transport chain of mitochondria. The small protein encoded by this gene plays a role in the biogenesis of mitochondrial complex IV. This protein localizes to the inner mitochondrial membrane and is exposed to the intermembrane space. Mutations in this gene are associated with mitochondrial complex IV deficiency. This gene has a pseudogene on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
  Transcript Variant: This variant (1) represents the shorter transcript and encodes the functional protein.