PET100 (NM_001171155) Human Untagged Clone

CAT#: SC328135

PET100 (untagged)-Human similar to hCG2036585 (LOC100131801) transcript variant 1


  "NM_001171155" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PET100"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PET100
Synonyms C19orf79
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001171155, the custom clone sequence may differ by one or more nucleotides


ATGGGGGTGAAGCTGGAGATATTTCGGATGATAATCTACCTCACTTTCCCTGTGGCTATGTTCTGGGTTT
CCAATCAGGCCGAGTGGTTTGAGGACGATGTCATACAGCGCAAGAGGGAGCTGTGGCCACCTGAGAAGCT
TCAAGAGATAGAGGAATTCAAAGAGAGGTTACGGAAGCGGCGGGAGGAGAAGCTCCTTCGCGACGCCCAG
CAGAACTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001171155
ORF Size 222 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001171155.1, NP_001164626.1
RefSeq Size 349
RefSeq ORF 222
Locus ID 100131801
Gene Summary Mitochondrial complex IV, or cytochrome c oxidase, is a large transmembrane protein complex that is part of the respiratory electron transport chain of mitochondria. The small protein encoded by this gene plays a role in the biogenesis of mitochondrial complex IV. This protein localizes to the inner mitochondrial membrane and is exposed to the intermembrane space. Mutations in this gene are associated with mitochondrial complex IV deficiency. This gene has a pseudogene on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (1) represents the shorter transcript and encodes the functional protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.