LST1 (NM_001166538) Human Untagged Clone
CAT#: SC328136
LST1 (untagged)-Human leukocyte specific transcript 1 (LST1) transcript variant 6
"NM_001166538" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | LST1 |
Synonyms | B144; D6S49E; LST-1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001166538, the custom clone sequence may differ by one or more nucleotides
ATGTTATCGCGGAATGATGTAAAGAGGCTGGAGAGGAGCTGGCACCTTCTGTCCTGGTCC CAGGCCCAGGGCTCCTCAGAGCAGGAACTCCACTATGCATCTCTGCAGAGGCTGCCAGTG CCCAGCAGTGAGGGACCTGACCTCAGGGGCAGAGACAAGAGAGGCACCAAGGAGGATCCA AGAGCTGACTATGCCTGCATTGCTGAGAACAAACCCACCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001166538 |
ORF Size | 222 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001166538.1, NP_001160010.1 |
RefSeq Size | 560 |
RefSeq ORF | 222 |
Locus ID | 7940 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene is a membrane protein that can inhibit the proliferation of lymphocytes. Expression of this gene is enhanced by lipopolysaccharide, interferon-gamma, and bacteria. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (6) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in an isoform (6) that is shorter than isoform 1. The 5' UTR of this variant is incomplete because the transcripts supporting this CDS exon combination lack a complete 5' UTR, and alternative splicing choices exist further upstream. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229498 | LST1 (Myc-DDK-tagged)-Human leukocyte specific transcript 1 (LST1), transcript variant 6 |
USD 420.00 |
|
RG229498 | LST1 (GFP-tagged) - Human leukocyte specific transcript 1 (LST1), transcript variant 6 |
USD 460.00 |
|
RC229498L3 | Lenti-ORF clone of LST1 (Myc-DDK-tagged)-Human leukocyte specific transcript 1 (LST1), transcript variant 6 |
USD 620.00 |
|
RC229498L4 | Lenti-ORF clone of LST1 (mGFP-tagged)-Human leukocyte specific transcript 1 (LST1), transcript variant 6 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review