NDUFA2 (NM_001185012) Human Untagged Clone

CAT#: SC328139

NDUFA2 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 2 8kDa (NDUFA2) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NDUFA2
• Synonyms: B8; CD14; CIB8; MC1DN13
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001185012, the custom clone sequence may differ by one or more nucleotides
  ATGGCGGCGGCCGCAGCAAGTCGAGGAGTCGGGGCAAAGCTGGGCCTGCGTGAGATTCGC
  ATCCACTTATGTCAGCGCTCGCCCGGCAGCCAGGGCGTCAGGGACTTCATTGAGAAACGC
  TACGTGGAGCTGAAGAAGGCGAATCCCGACCTACCCATCCTAATCCGCGAATGCTCCGAT
  GTGCAGCCCAAGCTCTGGGCCCGCTACGCCTCCAGGGTGCAGAATAGTTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001185012
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001185012.1, NP_001171941.1
• RefSeq Size: 773 bp
• RefSeq ORF: 231 bp
• Locus ID: 4695
• Cytogenetics: 5q31.3
• Protein Pathways: Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• Gene Summary: 'The encoded protein is a subunit of the hydrophobic protein fraction of the NADH:ubiquinone oxidoreductase (complex 1), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane, and may be involved in regulating complex I activity or its assembly via assistance in redox processes. Mutations in this gene are associated with Leigh syndrome, an early-onset progressive neurodegenerative disorder. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]'
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1. This results in a protein with a shorter and distinct C-terminus (isoform 2), compared to isoform 1. It is unknown if isoform 2 is located to the mitochondria and/or if it is functional.