BLCAP (NM_001167823) Human Untagged Clone

CAT#: SC328155

BLCAP (untagged)-Human bladder cancer associated protein (BLCAP) transcript variant 5


  "NM_001167823" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "BLCAP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BLCAP
Synonyms BC10
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001167823, the custom clone sequence may differ by one or more nucleotides
ATGTATTGCCTCCAGTGGCTGCTGCCCGTCCTCCTCATCCCCAAGCCCCTCAACCCCGCC
CTGTGGTTCAGCCACTCCATGTTCATGGGCTTCTACCTGCTCAGCTTCCTCCTGGAACGG
AAGCCTTGCACAATTTGTGCCTTGGTTTTCCTGGCAGCCCTGTTCCTTATCTGCTATAGC
TGCTGGGGAAACTGTTTCCTGTACCACTGCTCCGATTCCCCGCTTCCAGAATCGGCGCAT
GATCCCGGCGTTGTGGGCACCTAA
Restriction Sites Please inquire     
ACCN NM_001167823
ORF Size 264 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001167823.1, NP_001161295.1
RefSeq Size 2119
RefSeq ORF 264
Locus ID 10904
Protein Families Transmembrane
Gene Summary This gene encodes a protein that reduces cell growth by stimulating apoptosis. Alternative splicing and the use of alternative promoters result in multiple transcript variants encoding the same protein. This gene is imprinted in brain where different transcript variants are expressed from each parental allele. Transcript variants initiating from the upstream promoter are expressed preferentially from the maternal allele, while transcript variants initiating downstream of the interspersed NNAT gene (GeneID:4826) are expressed from the paternal allele. Transcripts at this locus may also undergo A to I editing, resulting in amino acid changes at three positions in the N-terminus of the protein. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1 to 7 all encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.