BLCAP (NM_001167820) Human Untagged Clone
CAT#: SC328156
BLCAP (untagged)-Human bladder cancer associated protein (BLCAP) transcript variant 2
"NM_001167820" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BLCAP |
Synonyms | BC10 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001167820, the custom clone sequence may differ by one or more nucleotides
ATGTATTGCCTCCAGTGGCTGCTGCCCGTCCTCCTCATCCCCAAGCCCCTCAACCCCGCC CTGTGGTTCAGCCACTCCATGTTCATGGGCTTCTACCTGCTCAGCTTCCTCCTGGAACGG AAGCCTTGCACAATTTGTGCCTTGGTTTTCCTGGCAGCCCTGTTCCTTATCTGCTATAGC TGCTGGGGAAACTGTTTCCTGTACCACTGCTCCGATTCCCCGCTTCCAGAATCGGCGCAT GATCCCGGCGTTGTGGGCACCTAA |
Restriction Sites | Please inquire |
ACCN | NM_001167820 |
ORF Size | 264 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001167820.1, NP_001161292.1 |
RefSeq Size | 2216 |
RefSeq ORF | 264 |
Locus ID | 10904 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a protein that reduces cell growth by stimulating apoptosis. Alternative splicing and the use of alternative promoters result in multiple transcript variants encoding the same protein. This gene is imprinted in brain where different transcript variants are expressed from each parental allele. Transcript variants initiating from the upstream promoter are expressed preferentially from the maternal allele, while transcript variants initiating downstream of the interspersed NNAT gene (GeneID:4826) are expressed from the paternal allele. Transcripts at this locus may also undergo A to I editing, resulting in amino acid changes at three positions in the N-terminus of the protein. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (6, also known as V1c) differs in the 5' UTR compared to variant 1. This variant may be expressed predominantly from the maternal allele in brain (PMID:18836209). Variants 1 to 7 all encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229518 | BLCAP (Myc-DDK-tagged)-Human bladder cancer associated protein (BLCAP), transcript variant 2 |
USD 420.00 |
|
RG229518 | BLCAP (GFP-tagged) - Human bladder cancer associated protein (BLCAP), transcript variant 2 |
USD 460.00 |
|
RC229518L3 | Lenti-ORF clone of BLCAP (Myc-DDK-tagged)-Human bladder cancer associated protein (BLCAP), transcript variant 2 |
USD 620.00 |
|
RC229518L4 | Lenti-ORF clone of BLCAP (mGFP-tagged)-Human bladder cancer associated protein (BLCAP), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review