MCFD2 (NM_001171509) Human Untagged Clone

CAT#: SC328161

MCFD2 (untagged)-Human multiple coagulation factor deficiency 2 (MCFD2) transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MCFD2
• Synonyms: F5F8D; F5F8D2; LMAN1IP; SDNSF
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001171509, the custom clone sequence may differ by one or more nucleotides
  ATGGAGCATCTAGAAGGTGTCATCAACAAACCAGAGGCGGAGATGTCGCCACAAGAATTG
  CAGCTCCATTACTTCAAAATGCATGATTATGATGGCAATAATTTGCTTGATGGCTTAGAA
  CTCTCCACAGCCATCACTCATGTCCATAAGGAGGAAGGGAGTGAACAGGCACCACTAATG
  AGTGAAGATGAACTGATTAACATAATAGATGGTGTTTTGAGAGATGATGACAAGAACAAT
  GATGGATACATTGACTATGCTGAATTTGCAAAATCACTGCAGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001171509
• ORF Size: 4041 bp
• Insert Size: 4041
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001171509.1, NP_001164980.1
• RefSeq Size: 4041
• RefSeq ORF: 4041
• Locus ID: 90411
• Gene Summary: This gene encodes a soluble luminal protein with two calmodulin-like EF-hand motifs at its C-terminus. This protein forms a complex with LMAN1 (lectin mannose binding protein 1; also known as ERGIC-53) that facilitates the transport of coagulation factors V (FV) and VIII (FVIII) from the endoplasmic reticulum to the Golgi apparatus via an endoplasmic reticulum Golgi intermediate compartment (ERGIC). Mutations in this gene cause combined deficiency of FV and FVIII (F5F8D); a rare autosomal recessive bleeding disorder characterized by mild to moderate bleeding and coordinate reduction in plasma FV and FVIII levels. This protein has also been shown to maintain stem cell potential in adult central nervous system and is a marker for testicular germ cell tumors. The 3' UTR of this gene contains a transposon-like human repeat element named 'THE 1'. A processed RNA pseudogene of this gene is on chromosome 6p22.1. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Apr 2016]
  Transcript Variant: This variant (5) lacks the first coding exon, compared to variant 1. This difference results in the use of an in-frame downstream start codon. The encoded protein (isoform B) has a shorter N-terminus, compared to isoform A, that is not predicted to have a signal peptide. Variants 5 and 6 encode the same isoform (B).