FAM104B (NM_001166699) Human Untagged Clone
CAT#: SC328188
FAM104B (untagged)-Human family with sequence similarity 104 member B (FAM104B) transcript variant 2
"NM_001166699" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FAM104B |
Synonyms | CXorf44 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001166699, the custom clone sequence may differ by one or more nucleotides
ATGGGAGGCTGCCCTGTACGGAAAAGAAGAAGAAATGGCAGTAAAGAGGGCAACCATCAT TCCACCCAGCCCAAAAGGAATAAGAGAAACCCTATCTTTCAGGATTCTCAAGATACAGAG GTATTTTCATGGAGTGATAATGAAAGGAGCAGCAGCCGCATTAATATCCCAGAGAGAGCA AGTGGACCAGAAGGCAACTTAAACCAGATTGTTACTGAACCCGATGCAAACTTTCCCCAG TTCTTGCATGAGGGATTGTCTAAACCTGTTTATGTCATAAACTGGTTTATGTCCTTTGGT CCTGAAATAAAACTCAATACTTCACAGCAGGGAAGGAACCAAGCTGTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_001166699 |
ORF Size | 351 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001166699.1, NP_001160171.1 |
RefSeq Size | 1095 |
RefSeq ORF | 351 |
Locus ID | 90736 |
Gene Summary | Belongs to the FAM104 family. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in an isoform (2) that is longer than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229550 | FAM104B (Myc-DDK-tagged)-Human family with sequence similarity 104, member B (FAM104B), transcript variant 2 |
USD 420.00 |
|
RG229550 | FAM104B (GFP-tagged) - Human family with sequence similarity 104, member B (FAM104B), transcript variant 2 |
USD 460.00 |
|
RC229550L3 | Lenti-ORF clone of FAM104B (Myc-DDK-tagged)-Human family with sequence similarity 104, member B (FAM104B), transcript variant 2 |
USD 620.00 |
|
RC229550L4 | Lenti-ORF clone of FAM104B (mGFP-tagged)-Human family with sequence similarity 104, member B (FAM104B), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review