GLT28D1 (ALG13) (NM_001168385) Human Untagged Clone

CAT#: SC328205

ALG13 (untagged)-Human asparagine-linked glycosylation 13 homolog (S. cerevisiae) (ALG13) transcript variant 4


  "NM_001168385" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ALG13"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ALG13
Synonyms CDG1S; CXorf45; EIEE36; GLT28D1; MDS031; TDRD13; YGL047W
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001168385, the custom clone sequence may differ by one or more nucleotides
ATGAAGTGCGTGTTTGTTACCGTAGGGACCACCAGCTTTGACGACCTCATTGCGTGTGTG
TCGGCGCCCGACAGTCTGCAAAAAATCGAGAGCCTTGGTTACAACCGACTTATCCTGCAA
ATTGGTAGAGGAACGGTGGTACCTGAACCCTTCAGTACTGAGTCGTTTACTCTGGATGTT
TACAGGTACAAGGATTCCTTGAAAGAAGACATTCAGAAAGCAGATCTTGTTATTAGTCAC
GCAGGTGCAGGAAGCTGTTTGGAGACTCTGGAAAAAGGAAAGCCACTCGTAGTGGTTATA
AACGAAAAGTTGATGAACAATCATCAGCTGGAACTGGCAAAGCAGCTACACAAAGAGGGT
CATCTCTTCTATTGTACCTGCAGTTCTTCCTTGAGACACTAG
Restriction Sites Please inquire     
ACCN NM_001168385
ORF Size 402 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001168385.1, NP_001161857.1
RefSeq Size 3031
RefSeq ORF 402
Locus ID 79868
Protein Pathways Metabolic pathways, N-Glycan biosynthesis
Gene Summary The protein encoded by this gene is a subunit of a bipartite UDP-N-acetylglucosamine transferase. It heterodimerizes with asparagine-linked glycosylation 14 homolog to form a functional UDP-GlcNAc glycosyltransferase that catalyzes the second sugar addition of the highly conserved oligosaccharide precursor in endoplasmic reticulum N-linked glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Transcript Variant: This variant (4) differs in the 3' UTR and 3' coding region, compared to variant 1. The resulting isoform (4) has a distinct C-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.