GLT28D1 (ALG13) (NM_001039210) Human Untagged Clone

CAT#: SC328210

ALG13 (untagged)-Human asparagine-linked glycosylation 13 homolog (S. cerevisiae) (ALG13) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ALG13
• Synonyms: CDG1S; CXorf45; EIEE36; GLT28D1; MDS031; TDRD13; YGL047W
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001039210, the custom clone sequence may differ by one or more nucleotides
  ATGAAGTGCGTGTTTGTTACCGTAGGGACCACCAGCTTTGACGACCTCATTGCGTGTGTG
  TCGGCGCCCGACAGTCTGCAAAAAATCGAGAGCCTTGGTTACAACCGACTTATCCTGCAA
  ATTGGTAGAGGAACGGTGGTACCTGAACCCTTCAGTACTGAGTCGTTTACTCTGGATGTT
  TACAGGTGCAGGAAGCTGTTTGGAGACTCTGGAAAAAGGAAAGCCACTCGTAGTGGTTAT
  AAACGAAAAGTTGATGAACAATCATCAGCTGGAACTGGCAAAGCAGCTACACAAAGAGGG
  TCATCTCTTCTATTGTACCTGCAGCACGCTTCCTGGGCTGTTACAGTCAATGGACTTATC
  AACACTGAAATGTTATCCTCCTGGCCAGCCAGAAAAATTTTCTGCATTTTTGGATAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001039210
• ORF Size: 417 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001039210.3, NP_001034299.3
• RefSeq Size: 2934
• RefSeq ORF: 417
• Locus ID: 79868
• Protein Pathways: Metabolic pathways, N-Glycan biosynthesis
• Gene Summary: The protein encoded by this gene is a subunit of a bipartite UDP-N-acetylglucosamine transferase. It heterodimerizes with asparagine-linked glycosylation 14 homolog to form a functional UDP-GlcNAc glycosyltransferase that catalyzes the second sugar addition of the highly conserved oligosaccharide precursor in endoplasmic reticulum N-linked glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
  Transcript Variant: This variant (3) differs in the 3' UTR and has multiple differences in the coding region, compared to variant 1. The resulting isoform (3) has a distinct C-terminus and is shorter than isoform 1.