GLT28D1 (ALG13) (NM_001039210) Human Untagged Clone
CAT#: SC328210
ALG13 (untagged)-Human asparagine-linked glycosylation 13 homolog (S. cerevisiae) (ALG13) transcript variant 3
"NM_001039210" in other vectors (4)
Product Images
![](https://origeneresource2.s3.us-east-2.amazonaws.com/cmsstatics/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ALG13 |
Synonyms | CDG1S; CXorf45; EIEE36; GLT28D1; MDS031; TDRD13; YGL047W |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001039210, the custom clone sequence may differ by one or more nucleotides
ATGAAGTGCGTGTTTGTTACCGTAGGGACCACCAGCTTTGACGACCTCATTGCGTGTGTG TCGGCGCCCGACAGTCTGCAAAAAATCGAGAGCCTTGGTTACAACCGACTTATCCTGCAA ATTGGTAGAGGAACGGTGGTACCTGAACCCTTCAGTACTGAGTCGTTTACTCTGGATGTT TACAGGTGCAGGAAGCTGTTTGGAGACTCTGGAAAAAGGAAAGCCACTCGTAGTGGTTAT AAACGAAAAGTTGATGAACAATCATCAGCTGGAACTGGCAAAGCAGCTACACAAAGAGGG TCATCTCTTCTATTGTACCTGCAGCACGCTTCCTGGGCTGTTACAGTCAATGGACTTATC AACACTGAAATGTTATCCTCCTGGCCAGCCAGAAAAATTTTCTGCATTTTTGGATAA |
Restriction Sites | Please inquire |
ACCN | NM_001039210 |
ORF Size | 417 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001039210.3, NP_001034299.3 |
RefSeq Size | 2934 |
RefSeq ORF | 417 |
Locus ID | 79868 |
Protein Pathways | Metabolic pathways, N-Glycan biosynthesis |
Gene Summary | The protein encoded by this gene is a subunit of a bipartite UDP-N-acetylglucosamine transferase. It heterodimerizes with asparagine-linked glycosylation 14 homolog to form a functional UDP-GlcNAc glycosyltransferase that catalyzes the second sugar addition of the highly conserved oligosaccharide precursor in endoplasmic reticulum N-linked glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009] Transcript Variant: This variant (3) differs in the 3' UTR and has multiple differences in the coding region, compared to variant 1. The resulting isoform (3) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229572 | ALG13 (Myc-DDK-tagged)-Human asparagine-linked glycosylation 13 homolog (S. cerevisiae) (ALG13), transcript variant 3 |
USD 420.00 |
|
RG229572 | ALG13 (GFP-tagged) - Human asparagine-linked glycosylation 13 homolog (S. cerevisiae) (ALG13), transcript variant 3 |
USD 460.00 |
|
RC229572L3 | Lenti-ORF clone of ALG13 (Myc-DDK-tagged)-Human asparagine-linked glycosylation 13 homolog (S. cerevisiae) (ALG13), transcript variant 3 |
USD 620.00 |
|
RC229572L4 | Lenti-ORF clone of ALG13 (mGFP-tagged)-Human asparagine-linked glycosylation 13 homolog (S. cerevisiae) (ALG13), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review