SDF1 (CXCL12) (NM_001178134) Human Untagged Clone

CAT#: SC328213

CXCL12 (untagged)-Human chemokine (C-X-C motif) ligand 12 (CXCL12) transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CXCL12
• Synonyms: IRH; PBSF; SCYB12; SDF1; TLSF; TPAR1
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001178134, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACGCCAAGGTCGTGGTCGTGCTGGTCCTCGTGCTGACCGCGCTCTGCCTCAGCGACGGGAAGCCCG
  TCAGCCTGAGCTACAGATGCCCATGCCGATTCTTCGAAAGCCATGTTGCCAGAGCCAACGTCAAGCATCT
  CAAAATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAGCCCGGCTGAAGAACAACAACAGACAAGTG
  TGCATTGACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGAAAGCTTTAAACAACCTGATCAGCGCCG
  CACCAGCCGGGAAGAGGGTGATTGCTGGGGCTCGTGCCCTGCATCCCTCTCCTCCCAGGGCCTGCCCCAC
  AGCTCGGGCCCTCTGTGAGATCCGTCTTTGGCCTCCTCCAGAATGGAGCTGGCCCTCTCCTGGGGATGTG
  TAA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_001178134
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001178134.1, NP_001171605.1
• RefSeq Size: 1209 bp
• RefSeq ORF: 423 bp
• Locus ID: 6387
• Cytogenetics: 10q11.21
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein
• Protein Pathways: Axon guidance, Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Leukocyte transendothelial migration
• Gene Summary: 'This antimicrobial gene encodes a stromal cell-derived alpha chemokine member of the intercrine family. The encoded protein functions as the ligand for the G-protein coupled receptor, chemokine (C-X-C motif) receptor 4, and plays a role in many diverse cellular functions, including embryogenesis, immune surveillance, inflammation response, tissue homeostasis, and tumor growth and metastasis. Mutations in this gene are associated with resistance to human immunodeficiency virus type 1 infections. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]'
  Transcript Variant: This variant (4) lacks an alternate segment, which results in a frameshift, compared to variant 1. The resulting protein (isoform delta) is longer and has a distinct C-terminus compared to isoform alpha.