NKAIN2 (NM_153355) Human Untagged Clone

CAT#: SC328215

NKAIN2 (untagged)-Human Na+/K+ transporting ATPase interacting 2 (NKAIN2) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NKAIN2
• Synonyms: FAM77B; NKAIP2; TCBA; TCBA1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_153355, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGTTATTGCAGTGGCAGGTGCACGCTTATCTTTATCTGTGGCATGCAACTGGTTTGTGTGCTGGAGA
  GGCAAATATTTGACTTCCTTGGATATCAGTGGGCACCTATCCTGGCAAATTTTGTACATATTATTATCGT
  CATTCTTGGTTTGTTTGGAACTATTCAATATAGACCTCGTTACATAACAGGATATGCTGTCTGGCTAGTC
  CTCTGGGTTACGTGGAATGTGTTTGTTATCTGCTTCTATTTGGAGGCTGGGGACCTCTCAAAGCTGGCAG
  GTTTCATCTACGCCTGTTATGTTGTGAAATGTATAACTGAAGAAGAGGACAGCTTTGATTTCATAGGTGG
  CTTTGACTCTTATGGCTATCAAGGGCCTCAGAAGACATCTCATTTACAACTACAGCCTATGTACATGTCA
  AAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_153355
• ORF Size: 426 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_153355.4, NP_699186.2
• RefSeq Size: 3192
• RefSeq ORF: 426
• Locus ID: 154215
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a transmembrane protein that interacts with the beta subunit of a sodium/potassium-transporting ATPase. A chromosomal translocation involving this gene is a cause of lymphoma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.