TRAPPC1 (NM_001166621) Human Untagged Clone

CAT#: SC328219

TRAPPC1 (untagged)-Human trafficking protein particle complex 1 (TRAPPC1) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TRAPPC1
• Synonyms: BET5; MUM2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001166621, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACTGTCCACAACCTGTACCTGTTTGACCGGAATGGAGTGTGTCTGCACTACAGCGAATGGCACCGCA
  AGAAGCAAGCAGGGATTCCCAAGGAGGAGGAGTATAAGCTGATGTACGGGATGCTCTTCTCTATCCGCTC
  GTTTGTCAGCAAGATGTCCCCGCTAGACATGAAGGATGGCTTCCTGGCCTTCCAAACTAGCCGTTACAAA
  CTCCATTACTACGAGACGCCCACTGGGATCAAAGTTGTCATGAATACTGACTTGGGCGTGGGACCCATCC
  GAGATGTGCTGCACCACATCTACAGTGCGCTGTATGTGGAGCTGGTGGTGAAGAATCCCCTGTGCCCGCT
  GGGCCAAACTGTGCAAAGTGAGCTCTTTCGCTCCCGACTGGACTCCTATGTTCGCTCTCTGCCCTTCTTC
  TCCGCCCGGGCTGGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001166621
• ORF Size: 438 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001166621.1, NP_001160093.1
• RefSeq Size: 777
• RefSeq ORF: 438
• Locus ID: 58485
• Gene Summary: This gene product plays a role in vesicular transport of proteins to the Golgi apparatus from the endoplasmic reticulum. The encoded protein is a component of the multisubunit transport protein particle (TRAPP) complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.