Caveolin 1 (CAV1) (NM_001172896) Human Untagged Clone

CAT#: SC328228

CAV1 (untagged)-Human caveolin 1 caveolae protein 22kDa (CAV1) transcript variant 3


  "NM_001172896" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CAV1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CAV1
Synonyms BSCL3; CGL3; LCCNS; MSTP085; PPH3; VIP21
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001172896, the custom clone sequence may differ by one or more nucleotides
ATGGCAGACGAGCTGAGCGAGAAGCAAGTGTACGACGCGCACACCAAGGAGATCGACCTG
GTCAACCGCGACCCTAAACACCTCAACGATGACGTGGTCAAGATTGACTTTGAAGATGTG
ATTGCAGAACCAGAAGGGACACACAGTTTTGACGGCATTTGGAAGGCCAGCTTCACCACC
TTCACTGTGACGAAATACTGGTTTTACCGCTTGCTGTCTGCCCTCTTTGGCATCCCGATG
GCACTCATCTGGGGCATTTACTTCGCCATTCTCTCTTTCCTGCACATCTGGGCAGTTGTA
CCATGCATTAAGAGCTTCCTGATTGAGATTCAGTGCATCAGCCGTGTCTATTCCATCTAC
GTCCACACCGTCTGTGACCCACTCTTTGAAGCTGTTGGGAAAATATTCAGCAATGTCCGC
ATCAACTTGCAGAAAGAAATATAA
Restriction Sites Please inquire     
ACCN NM_001172896
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001172896.1, NP_001166367.1
RefSeq Size 2647 bp
RefSeq ORF 444 bp
Locus ID 857
Cytogenetics 7q31.2
Protein Families Druggable Genome, Transmembrane
Protein Pathways Focal adhesion, Viral myocarditis
Gene Summary 'The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1.[provided by RefSeq, Mar 2010]'
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (beta) is shorter than isoform alpha. Variants 2, 3 and 4 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.