TMEM216 (NM_001173991) Human Untagged Clone

CAT#: SC328231

TMEM216 (untagged)-Human transmembrane protein 216 (TMEM216) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TMEM216
• Synonyms: HSPC244
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001173991, the custom clone sequence may differ by one or more nucleotides
  ATGCTGCCACGGGGACTGAAGATGGCGCCGCGAGGTAAACGGTTGTCCTCCACCCCGCTG
  GAAATCCTGTTCTTTCTGAACGGGTGGTATAATGCTACCTATTTCCTGCTGGAACTTTTC
  ATATTTCTGTATAAAGGTGTCCTGCTACCATATCCAACAGCTAACCTAGTACTGGATGTG
  GTGATGCTCCTCCTTTATCTTGGAATTGAAGTAATTCGCCTGTTTTTTGGTACAAAGGGA
  AACCTCTGCCAGCGAAAGATGCCGCTCAGTATTAGCGTGGCCTTGACCTTCCCATCTGCC
  ATGATGGCCTCCTATTACCTGCTGCTGCAGACCTACGTACTCCGCCTGGAAGCCATCATG
  AATGGCATCTTGCTCTTCTTCTGTGGCTCAGAGCTTTTACTTGAGGTGCTCACCTTGGCT
  GCTTTCTCCAGTATGGACAGGATTTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001173991
• ORF Size: 447 bp
• Insert Size: 1306
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001173991.1, NP_001167462.1
• RefSeq Size: 1306
• RefSeq ORF: 447
• Locus ID: 51259
• Protein Families: Transmembrane
• Gene Summary: This locus encodes a transmembrane domain-containing protein. Mutations at this locus have been associated with Meckel-Gruber Syndrome Type 2, and Joubert Syndrome 2, also known as Cerebello-oculorenal Syndrome 2. [provided by RefSeq, Aug 2010]
  Transcript Variant: This variant (3) uses an alternate splice site and initiates translation at an upstream start codon, compared to variant 1. The resulting isoform (3) has a longer N-terminus, compared to isoform 1.