MDFIC (NM_001166346) Human Untagged Clone

CAT#: SC328234

MDFIC (untagged)-Human MyoD family inhibitor domain containing (MDFIC) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MDFIC
• Synonyms: HIC; MDFIC1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001166346, the custom clone sequence may differ by one or more nucleotides
  GTGCGCGGAGTCAGAGCCGCCACCGCTGCCGCAGTTGCCGCCACTGCGGCGTCTGGGCTG
  AGCCGGAGGGAGGCGGGAGGACGCGCAGGGGCGGCCGCCGCCGTCGTCAGGCCACCGGGG
  CGAAAATGCGGCCGCTGCCGGAGGCTCGCTAACTTTCCGGGGCGGAAGAGGAGGAGGAGG
  AGGAGGAAGGGGCTTGGAGCGACTACGGGGGGATGCGGAGAAGCAGTCAGTTCCCTGCAC
  CCAGCACCTCACAGCCCTTCCTCCGTGCGCCCTGCCGGGCGGCGAGCTAGGCGGCAGCGG
  CGCGGCGCGGGCTCGGCGGAGCGGCCCATGTCCGGCGCGGGCGAAGCCCTCGCTCCCGGG
  CCCGTGGGGCCGCAGCGCGTGGCCGAGGCGGGCGGCGGCCAGCTGGGCTCCACAGCCCAG
  GGTCTCTTCAGCAGATCCAGGACTGCCGCAGCTCTCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001166346
• ORF Size: 459 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001166346.1, NP_001159818.3
• RefSeq Size: 891
• RefSeq ORF: 459
• Locus ID: 29969
• Gene Summary: This gene product is a member of a family of proteins characterized by a specific cysteine-rich C-terminal domain, which is involved in transcriptional regulation of viral genome expression. Alternative translation initiation from an upstream non-AUG (GUG), and an in-frame, downstream AUG codon, results in the production of two isoforms, p40 and p32, respectively, which have different subcellular localization; p32 is mainly found in the cytoplasm, whereas p40 is targeted to the nucleolus. Both isoforms have transcriptional regulatory activity that is attributable to the cysteine-rich C-terminal domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
  Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (c) has a distinct and shorter C-terminus, compared to isoform p40.