BEX2 (NM_001168400) Human Untagged Clone

CAT#: SC328249

BEX2 (untagged)-Human brain expressed X-linked 2 (BEX2) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BEX2
• Synonyms: BEX1; DJ79P11.1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001168400, the custom clone sequence may differ by one or more nucleotides
  ATGCAGAAAATGGTTTGCGGGGCCAAGTGTTGCGGCGACGCACCTCACGTCGAGAATCGG
  GAGGAGGAGACTGCAAGGATAGGCCCAGGAGTAATGGAGTCCAAAGAGGAACGAGCGTTA
  AACAATCTCATCGTGGAAAATGTCAACCAGGAAAATGATGAAAAAGATGAAAAGGAGCAA
  GTTGCTAATAAAGGGGAGCCCTTGGCCCTACCTTTGAATGTTAGTGAATACTGTGTGCCT
  AGAGGAAACCGTAGGCGGTTCCGCGTTAGGCAGCCCATCCTGCAGTATAGATGGGACATA
  ATGCATAGGCTTGGAGAGCCACAGGCAAGGATGAGAGAGGAGAATATGGAAAGGATTGGG
  GAGGAGGTGAGACAGCTGATGGAAAAGCTGAGGGAAAAGCAGTTGAGTCATAGTTTGCGG
  GCAGTCAGCACTGATCCCCCTCACCATGACCATCACGATGAGTTTTGCCTTATGCCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001168400
• ORF Size: 480 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001168400.1, NP_001161872.1
• RefSeq Size: 1097
• RefSeq ORF: 480
• Locus ID: 84707
• Gene Summary: This gene belongs to the brain expressed X-linked gene family. The encoded protein interacts with the transcription factor LIM domain only 2 in a DNA-binding complex that recognizes the E-box element and promotes transcription. This gene has been found to be a tumor suppressor that is silenced in human glioma. In breast cancer cells, this gene product modulates apoptosis in response to estrogen and tamoxifen, and enhances the anti-proliferative effect of tamoxifen. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. This results in a shorter protein (isoform 2) compared to isoform 1.