MYD88 (NM_001172566) Human Untagged Clone
CAT#: SC328250
MYD88 (untagged)-Human myeloid differentiation primary response gene (88) (MYD88) transcript variant 5
"NM_001172566" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MYD88 |
Synonyms | MYD88D |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001172566, the custom clone sequence may differ by one or more nucleotides
ATGCGACCCGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCCCGGCGCGGGGTCTG CGGCCCCGGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTCAACATGCGAGTGCGGCGCCGCCTGTC TCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGGACCGCGCTGGCGGAGGAGATGGACTTTGAG TACTTGGAGATCCGGCAACTGGAGACACAAGCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAGGGAC GCCCTGGCGCCTCTGTAGGCCGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGCTGCTGGA GCTGGGACCCAGCATTGGTGCCGCCGGATGGTGGTGGTTGTCTCTGATGATTACCTGCAGAGCAAGGAAT GTGACTTCCAGACCAAATTTGCACTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001172566 |
ORF Size | 480 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001172566.1, NP_001166037.1 |
RefSeq Size | 2546 |
RefSeq ORF | 480 |
Locus ID | 4615 |
Protein Families | Druggable Genome |
Protein Pathways | Apoptosis, Toll-like receptor signaling pathway |
Gene Summary | This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010] Transcript Variant: This variant (5) lacks two exons in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (5) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229612 | MYD88 (Myc-DDK-tagged)-Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 5 |
USD 420.00 |
|
RG229612 | MYD88 (GFP-tagged) - Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 5 |
USD 460.00 |
|
RC229612L3 | Lenti ORF clone of Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 5, Myc-DDK-tagged |
USD 620.00 |
|
RC229612L4 | Lenti ORF clone of Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 5, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review