BEX2 (NM_001168399) Human Untagged Clone
CAT#: SC328251
BEX2 (untagged)-Human brain expressed X-linked 2 (BEX2) transcript variant 1
"NM_001168399" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BEX2 |
Synonyms | BEX1; DJ79P11.1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001168399, the custom clone sequence may differ by one or more nucleotides
ATGCAGAAAATGGTGGTTTGCGGGGCCAAGTGTTGCGGCGACGCACCTCACGTCGAGAAT CGGGAGGAGGAGACTGCAAGGATAGGCCCAGGAGTAATGGAGTCCAAAGAGGAACGAGCG TTAAACAATCTCATCGTGGAAAATGTCAACCAGGAAAATGATGAAAAAGATGAAAAGGAG CAAGTTGCTAATAAAGGGGAGCCCTTGGCCCTACCTTTGAATGTTAGTGAATACTGTGTG CCTAGAGGAAACCGTAGGCGGTTCCGCGTTAGGCAGCCCATCCTGCAGTATAGATGGGAC ATAATGCATAGGCTTGGAGAGCCACAGGCAAGGATGAGAGAGGAGAATATGGAAAGGATT GGGGAGGAGGTGAGACAGCTGATGGAAAAGCTGAGGGAAAAGCAGTTGAGTCATAGTTTG CGGGCAGTCAGCACTGATCCCCCTCACCATGACCATCACGATGAGTTTTGCCTTATGCCC TGA |
Restriction Sites | Please inquire |
ACCN | NM_001168399 |
ORF Size | 483 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001168399.1, NP_001161871.1 |
RefSeq Size | 1100 |
RefSeq ORF | 483 |
Locus ID | 84707 |
Gene Summary | This gene belongs to the brain expressed X-linked gene family. The encoded protein interacts with the transcription factor LIM domain only 2 in a DNA-binding complex that recognizes the E-box element and promotes transcription. This gene has been found to be a tumor suppressor that is silenced in human glioma. In breast cancer cells, this gene product modulates apoptosis in response to estrogen and tamoxifen, and enhances the anti-proliferative effect of tamoxifen. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229613 | BEX2 (Myc-DDK-tagged)-Human brain expressed X-linked 2 (BEX2), transcript variant 1 |
USD 420.00 |
|
RG229613 | BEX2 (GFP-tagged) - Human brain expressed X-linked 2 (BEX2), transcript variant 1 |
USD 460.00 |
|
RC229613L3 | Lenti-ORF clone of BEX2 (Myc-DDK-tagged)-Human brain expressed X-linked 2 (BEX2), transcript variant 1 |
USD 620.00 |
|
RC229613L4 | Lenti-ORF clone of BEX2 (mGFP-tagged)-Human brain expressed X-linked 2 (BEX2), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review