KLHL7 (NM_001172428) Human Untagged Clone
CAT#: SC328258
KLHL7 (untagged)-Human kelch-like 7 (Drosophila) (KLHL7) transcript variant 3
"NM_001172428" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KLHL7 |
Synonyms | CISS3; KLHL6; SBBI26 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001172428, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCCTCTGGGGTGGAGAAGAGCAGCAAGAAGAAGACCGAGAAGAAACTTGCTGCT CGGGAAGAAGCTAAATTGTTGGCGGGTTTCATGGGCGTCATGAATAACATGCGGAAACAG AAAACGTTGTGTGACGTGATCCTCATGGTCCAGGAAAGAAAGATACCTGCTCATCGTGTT GTTCTTGCTGCAGCCAGTCATTTTTTTAACTTAATGTTCACAACTAACATGCTTGAATCA AAGTCCTTTGAAGTAGAACTCAAAGATGCTGAACCTGATATTATTGAACAACTGGTGGAA TTTGCTTATACTGCTAGAATTTCCGTGAATAGCAACAATGTTCAGTCTTTGCTGGATGCA GCAAACCAATATCAGATTGAACCTGTGAAGAAAATGTGTGTTGATTTTTTGAAAGAACAA GTTGATGCTTCAAATTGTCTTGGAGAAGCAGAAAAAGTTGATCAGAGCCTTCCAGAGTGT GGTATGCTTTTCACTGTGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001172428 |
ORF Size | 501 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001172428.1, NP_001165899.1 |
RefSeq Size | 1032 |
RefSeq ORF | 501 |
Locus ID | 55975 |
Gene Summary | This gene encodes a BTB-Kelch-related protein. The encoded protein may be involved in protein degradation. Mutations in this gene have been associated with retinitis pigmentosa 42. [provided by RefSeq, Feb 2010] Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (3) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229620 | KLHL7 (Myc-DDK-tagged)-Human kelch-like 7 (Drosophila) (KLHL7), transcript variant 3 |
USD 420.00 |
|
RG229620 | KLHL7 (GFP-tagged) - Human kelch-like 7 (Drosophila) (KLHL7), transcript variant 3 |
USD 460.00 |
|
RC229620L3 | Lenti-ORF clone of KLHL7 (Myc-DDK-tagged)-Human kelch-like 7 (Drosophila) (KLHL7), transcript variant 3 |
USD 620.00 |
|
RC229620L4 | Lenti-ORF clone of KLHL7 (mGFP-tagged)-Human kelch-like 7 (Drosophila) (KLHL7), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review