KLHL7 (NM_001172428) Human Untagged Clone

CAT#: SC328258

KLHL7 (untagged)-Human kelch-like 7 (Drosophila) (KLHL7) transcript variant 3


  "NM_001172428" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KLHL7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KLHL7
Synonyms CISS3; KLHL6; SBBI26
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001172428, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCCTCTGGGGTGGAGAAGAGCAGCAAGAAGAAGACCGAGAAGAAACTTGCTGCT
CGGGAAGAAGCTAAATTGTTGGCGGGTTTCATGGGCGTCATGAATAACATGCGGAAACAG
AAAACGTTGTGTGACGTGATCCTCATGGTCCAGGAAAGAAAGATACCTGCTCATCGTGTT
GTTCTTGCTGCAGCCAGTCATTTTTTTAACTTAATGTTCACAACTAACATGCTTGAATCA
AAGTCCTTTGAAGTAGAACTCAAAGATGCTGAACCTGATATTATTGAACAACTGGTGGAA
TTTGCTTATACTGCTAGAATTTCCGTGAATAGCAACAATGTTCAGTCTTTGCTGGATGCA
GCAAACCAATATCAGATTGAACCTGTGAAGAAAATGTGTGTTGATTTTTTGAAAGAACAA
GTTGATGCTTCAAATTGTCTTGGAGAAGCAGAAAAAGTTGATCAGAGCCTTCCAGAGTGT
GGTATGCTTTTCACTGTGTGA
Restriction Sites Please inquire     
ACCN NM_001172428
ORF Size 501 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001172428.1, NP_001165899.1
RefSeq Size 1032
RefSeq ORF 501
Locus ID 55975
Gene Summary This gene encodes a BTB-Kelch-related protein. The encoded protein may be involved in protein degradation. Mutations in this gene have been associated with retinitis pigmentosa 42. [provided by RefSeq, Feb 2010]
Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (3) has a distinct C-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.