RRAS2 (NM_001177314) Human Untagged Clone

CAT#: SC328265

RRAS2 (untagged)-Human related RAS viral (r-ras) oncogene homolog 2 (RRAS2) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RRAS2
• Synonyms: TC21
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001177314, the custom clone sequence may differ by one or more nucleotides
  ATGTCCTATTTTGTAACGGATTATGATCCAACCATTGAAGATTCTTACACAAAGCAGTGT
  GTGATAGATGACAGAGCAGCCCGGCTAGATATTTTGGATACAGCAGGACAAGAAGAGTTT
  GGAGCCATGAGAGAACAGTATATGAGGACTGGCGAAGGCTTCCTGTTGGTCTTTTCAGTC
  ACAGATAGAGGCAGTTTTGAAGAAATCTATAAGTTTCAAAGACAGATTCTCAGAGTAAAG
  GATCGTGATGAGTTCCCAATGATTTTAATTGGTAATAAAGCAGATCTGGATCATCAAAGA
  CAGGTAACACAGGAAGAAGGACAACAGTTAGCACGGCAGCTTAAGGTAACATACATGGAG
  GCATCAGCAAAGATTAGGATGAATGTAGATCAAGCTTTCCATGAACTTGTCCGGGTTATC
  AGGAAATTTCAAGAGCAGGAATGTCCTCCTTCACCAGAACCAACACGGAAAGAAAAAGAC
  AAGAAAGGCTGCCATTGTGTCATTTTCTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001177314
• ORF Size: 510 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001177314.1, NP_001170785.1
• RefSeq Size: 2054
• RefSeq ORF: 510
• Locus ID: 22800
• Protein Families: Druggable Genome
• Protein Pathways: MAPK signaling pathway, Regulation of actin cytoskeleton, Tight junction
• Gene Summary: This gene encodes a member of the R-Ras subfamily of Ras-like small GTPases. The encoded protein associates with the plasma membrane and may function as a signal transducer. This protein may play an important role in activating signal transduction pathways that control cell proliferation. Mutations in this gene are associated with the growth of certain tumors. Pseudogenes of this gene are found on chromosomes 1 and 2. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
  Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The resulting isoform (b) is shorter and has a distinct N-terminus compared to isoform a.