GM2A (NM_001167607) Human Untagged Clone

CAT#: SC328285

GM2A (untagged)-Human GM2 ganglioside activator (GM2A) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GM2A
• Synonyms: GM2-AP; SAP-3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001167607, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGTCCCTGATGCAGGCTCCCCTCCTGATCGCCCTGGGCTTGCTTCTCGCGGCCCCTGCGCAAGCCC
  ACCTGAAAAAGCCATCCCAGCTCAGTAGCTTTTCCTGGGATAACTGTGATGAAGGGAAGGACCCTGCGGT
  GATCAGAAGCCTGACTCTGGAGCCTGACCCCATCATCGTTCCTGGAAATGTGACCCTCAGTGTCATGGGC
  AGCACCAGTGTCCCCCTGAGTTCTCCTCTGAAGGTGGATTTAGTTTTGGAGAAGGAGGTGGCTGGCCTCT
  GGATCAAGATCCCATGCACAGACTACATTGGCAGCTGTACCTTTGAACACTTCTGTGATGTGCTTGACAT
  GTTAATTCCTACTGGGGAGCCCTGCCCAGAGCCCCTGCGTACCTATGGGCTTCCTTGCCACTGTCCCTTT
  TCCTCTGTTTTGTGTTTGCCAAGGCCAAACTCCCACTCTCTGCCCCCCTTTAATCCCCTTTCTACAGTGA
  GTCCACTACCCTCACTGAAAATCATTTTGTACCACTTACATTTTAGGCTGGGGCAAGCAGCCCTGACCTA
  A
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001167607
• ORF Size: 561 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001167607.1, NP_001161079.1
• RefSeq Size: 3480
• RefSeq ORF: 561
• Locus ID: 2760
• Protein Families: Druggable Genome
• Protein Pathways: Lysosome
• Gene Summary: This gene encodes a small glycolipid transport protein which acts as a substrate specific co-factor for the lysosomal enzyme beta-hexosaminidase A. Beta-hexosaminidase A, together with GM2 ganglioside activator, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Mutations in this gene result in GM2-gangliosidosis type AB or the AB variant of Tay-Sachs disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
  Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.