RABL4 (IFT27) (NM_001177701) Human Untagged Clone

CAT#: SC328286

IFT27 (untagged)-Human intraflagellar transport 27 homolog (Chlamydomonas) (IFT27) transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IFT27
• Synonyms: BBS19; RABL4; RAYL
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001177701, the custom clone sequence may differ by one or more nucleotides
  ATGGTGAAGCTGGCAGCCAAATGCATCCTGGCAGGAGACCCAGCAGTGGGCAAGACCGCC
  CTGGCACAGATCTTCCGCAGTGATGGAGCCCATTTCCAGAAAAGCTACACCCTGACAACA
  GGAATGGATTTGGTGGTGAAGACAGTGCCAGTTCCTGACACGGGAGACAGTGTGGAACTC
  TTCATTTTTGACTCTGCTGGCAAGGAGCTGTTTTCGGAAATGCTGGATAAATTGTGGGAG
  AGTCCCAATGTCTTATGTCTCGTCTATGATGTGACCAATGAAGAATCCTTCAACAACTGC
  AGCAAGTGGCTGGAGAAGGCTCGGTCACAGGCTCCAGGCATCTCTCTCCCAGGTGTTTTA
  GTTGGGAACAAGACAGACCTGGCCGGCAGACGAGCAGTGGACTCAGCTGAGGCCCGGGCA
  TGGGCGCTGGGCCAGGGCCTGGAATGTTTTGAAACATCCGTGAAAGAGATGGAAAACTTC
  GAAGCCCCTTTCCACTGCCTTGCCAAGCAGTTCCACCAGCTGTACCGGGAGAAGGTGGAG
  GTTTTCCGGGCCCTGGCATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001177701
• ORF Size: 1104 bp
• Insert Size: 1104
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001177701.1, NP_001171172.1
• RefSeq Size: 1104
• RefSeq ORF: 1104
• Locus ID: 11020
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a GTP-binding protein that is a core component of the intraflagellar transport complex B. Characterization of the similar Chlamydomonas protein indicates a function in cell cycle control. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Both variants 1 and 5 encode isoform 1.