LOX 1 (OLR1) (NM_001172633) Human Untagged Clone

CAT#: SC328295

OLR1 (untagged)-Human oxidized low density lipoprotein (lectin-like) receptor 1 (OLR1) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OLR1
• Synonyms: CLEC8A; LOX1; LOXIN; SCARE1; SLOX1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001172633, the custom clone sequence may differ by one or more nucleotides
  ATGACTTTTGATGACCTAAAGATCCAGACTGTGAAGGACCAGCCTGATGAGAAGTCAAAT
  GGAAAAAAAGCTAAAGGTCTTCAGTTTCTTTACTCTCCATGGTGGTGCCTGGCTGCTGCG
  ACTCTAGGGGTCCTTTGCCTGGGATTAGTAGTGACCATTATGGTGCTGGGCATGCAATTA
  TCCCAGGTGTCTGACCTCCTAACACAAGAGCAAGCAAACCTAACTCACCAGAAAAAGAAA
  CTGGAGGGACAGATCTCAGCCCGGCAACAAGCAGAAGAAGCTTCACAGGAGTCAGAAAAC
  GAACTCAAGGAAATGATAGAAACCCTTGCTCGGAAGCTGAATGAGAAATCCAAAGAGCAA
  ATGGAACTTCACCACCAGAATCTGAATCTCCAAGAAACACTGAAGAGAGTAGCAAATTGT
  TCAGCTCCTTGTCCGCAAGACTGGATCTGGCATGGAGAAAACTGTTACCTATTTTCCTCG
  GGCTCATTTAACTGGGAAAAGAGCCAAGAGAAGTGCTTGTCTTTGGATGCCAAGTTGCTG
  AAAATTAATAGCACAGCTGATCTGATTTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001172633
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001172633.1, NP_001166104.1
• RefSeq Size: 2417 bp
• RefSeq ORF: 570 bp
• Locus ID: 4973
• Cytogenetics: 12p13.2
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: PPAR signaling pathway
• Gene Summary: 'This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]'
  Transcript Variant: This variant (3) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.