RNF4 (NM_001185009) Human Untagged Clone

CAT#: SC328297

RNF4 (untagged)-Human ring finger protein 4 (RNF4) transcript variant 1


  "NM_001185009" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "RNF4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RNF4
Synonyms RES4-26; SLX5; SNURF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene SC328297 ORF sequence for NM_001185009, the custom clone sequence may differ by one or more nucleotides


ATGAGTACAAGAAAGCGTCGTGGTGGAGCAATAAATTCTAGACAAGCTCAGAAGCGAACTCGGGAAGCAA
CCTCCACCCCCGAGATCTCCTTGGAAGCAGAACCCATAGAACTCGTGGAAACTGCTGGAGATGAAATTGT
GGACCTCACTTGTGAATCTTTAGAGCCTGTGGTGGTTGATCTGACTCACAATGACTCTGTTGTGATTGTT
GACGAAAGAAGAAGACCAAGGAGGAATGCTAGGAGGCTGCCCCAGGACCATGCTGACAGCTGTGTGGTGA
GCAGTGACGATGAGGAGTTGTCCAGGGACAGAGACGTATATGTGACTACCCATACTCCCAGAAACGCCAG
GGATGAGGGCGCTACAGGCCTCAGGCCCTCAGGTACTGTCAGTTGTCCCATCTGCATGGACGGATACTCA
GAGATCGTGCAGAATGGACGTCTCATCGTTTCCACAGAATGCGGCCATGTCTTCTGTAGCCAGTGCCTCC
GTGATTCCCTGAAGAATGCTAATACTTGCCCAACTTGTAGGAAAAAGATCAACCACAAACGGTACCACCC
CATTTATATATGA


Restriction Sites SgfI-MluI     
ACCN NM_001185009
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001185009.1, NP_001171938.1
RefSeq Size 3493 bp
RefSeq ORF 573 bp
Locus ID 6047
Cytogenetics 4p16.3
Protein Families Transcription Factors
Gene Summary 'The protein encoded by this gene contains a RING finger motif and acts as a transcription regulator. This protein has been shown to interact with, and inhibit the activity of, TRPS1, a transcription suppressor of GATA-mediated transcription. Transcription repressor ZNF278/PATZ is found to interact with this protein, and thus reduce the enhancement of androgen receptor-dependent transcription mediated by this protein. Studies of the mouse and rat counterparts suggested a role of this protein in spermatogenesis. A pseudogene of this gene is found on chromosome 1.[provided by RefSeq, Jul 2010]'
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Both variants 1 and 2 encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.