FAM3A (NM_001171133) Human Untagged Clone

CAT#: SC328302

FAM3A (untagged)-Human family with sequence similarity 3 member A (FAM3A) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FAM3A
• Synonyms: 2.19; DLD; DXS560S; XAP-7
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001171133, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGGTTGGCAGGTCCAGAGAGCTCGGTGACTGCAGCGCCACGGGCCAGGAAGTACAAGTGTGGCCTGC
  CCCAGCCGTGTCCTGAGGAGCACCTGGCCTTCCGCGTGGTCAGCGGGGCCGCCAACGTCATTGGGCCCAA
  GATCTGCCTCGAGGACAAGATGCTGATGAGCAGCGTCAAGGACAACGTGGGCCGCGGGCTGAACATCGCC
  CTGGTGAACGGGGTCAGCGGCGAGCTCATCGAGGCCCGGGCCTTTGACATGTGGGCCGGAGATGTCAACG
  ACCTGTTGAAGTTTATTCGGCCACTGCACGAAGGCACCCTGGTGTTCGTGGCATCCTACGACGACCCAGC
  CACCAAGATGAATGAAGAGACCAGAAAGCTCTTCAGTGAGCTGGGCAGCAGGAACGCCAAGGAGCTGGCC
  TTCCGGGACAGCTGGGTGTTTGTCGGGGCCAAGGGTGTGCAGAACAAGAGCCCCTTTGAGCAGCACGTGA
  AGAACAGTAAGCACAGCAACAAGTACGAAGGCTGGCCCGAGGCGCTGGAGATGGAAGGCTGTATCCCGCG
  GAGAAGCACGGCCAGCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001171133
• ORF Size: 579 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001171133.2, NP_001164604.1
• RefSeq Size: 1610
• RefSeq ORF: 579
• Locus ID: 60343
• Protein Families: Secreted Protein, Transmembrane
• Gene Summary: This gene encodes a cytokine-like protein. The expression of this gene may be regulated by peroxisome proliferator-activated receptor gamma, and the encoded protein may be involved in the regulation of glucose and lipid metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (3) differs in the 5' UTR and lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.