AMMECR1 (NM_001171689) Human Untagged Clone

CAT#: SC328327

AMMECR1 (untagged)-Human Alport syndrome mental retardation midface hypoplasia and elliptocytosis chromosomal region gene 1 (AMMECR1) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AMMECR1
• Synonyms: AMMERC1; MFHIEN
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001171689, the custom clone sequence may differ by one or more nucleotides
  ATGGTGGTGTCAGCAGAGATGTGCTGCTTTTGCTTCGATGTGCTCTACTGTCACCTGTAT
  GGATACCAGCAGCCCCGGACCCCCCGATTCACCAACGAGCCCTACCCACTGTTTGTAACA
  TGGAAGATTGGTCGAGACAAAAGATTACGTGGATGCATAGGTACTTTTTCTGCCATGAAT
  TTGCATTCAGGACTCAGGGAGTACACACTTACCAGTGCCCTTAAAGATAGCCGTTTTCCC
  CCAATGACAAGGGATGAGCTGCCACGGCTTTTCTGCTCAGTGTCTCTGCTCACTAACTTT
  GAAGATGTCTGTGATTATTTGGACTGGGAGGTGGGTGTACATGGCATTAGAATAGAATTC
  ATCAATGAAAAAGGATCAAAACGCACCGCCACCTACCTACCGGAGGTTGCAAAGGAGCAA
  GGATGGGACCATATACAGACCATAGACTCCTTATTGAGGAAAGGAGGATACAAAGCTCCG
  ATTACTAATGAATTCAGGAAAACCATAAAACTGACCAGGTATCGTAGTGAAAAGATGACC
  CTGAGCTATGCTGAATACCTTGCTCATCGCCAGCATCATCATTTCCAAAATGGCATTGGG
  CATCCCCTTCCGCCATACAACCATTATTCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001171689
• ORF Size: 633 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001171689.1, NP_001165160.1
• RefSeq Size: 5618
• RefSeq ORF: 633
• Locus ID: 9949
• Protein Families: Druggable Genome
• Gene Summary: The exact function of this gene is not known, however, submicroscopic deletion of the X chromosome including this gene, COL4A5, and FACL4 genes, result in a contiguous gene deletion syndrome, the AMME complex (Alport syndrome, mental retardation, midface hypoplasia, and elliptocytosis). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
  Transcript Variant: This variant (3) differs at the 5' end compared to variant 1, resulting in translation initiation from an in-frame downstream AUG, and a shorter isoform (3) compared to isoform 1.