SENP8 (NM_001172109) Human Untagged Clone

CAT#: SC328332

SENP8 (untagged)-Human SUMO/sentrin specific peptidase family member 8 (SENP8) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SENP8
• Synonyms: DEN1; NEDP1; PRSC2
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001172109, the custom clone sequence may differ by one or more nucleotides
  ATGGACCCCGTAGTCTTGAGTTACATGGACAGTCTACTGCGGCAATCAGATGTCTCACTA
  TTGGATCCGCCAAGCTGGCTCAATGACCATATTATTGGGTTTGCGTTTGAGTACTTTGCC
  AACAGTCAGTTTCATGACTGCTCTGATCACGTCAGTTTCATCAGCCCTGAAGTCACCCAG
  TTCATCAAGTGCACTAGCAACCCAGCAGAGATTGCCATGTTCCTTGAACCACTGGACCTC
  CCCAACAAGAGAGTTGTATTTTTAGCCATCAATGATAACTCCAACCAGGCAGCTGGAGGA
  ACCCACTGGAGTTTATTGGTCTACCTCCAAGATAAAAATAGCTTTTTTCATTATGATTCC
  CATAGCAGGAGCAACTCAGTTCACGCAAAGCAGGTAGCAGAGAAACTGGAGGCTTTCTTA
  GGCAGAAAAGGAGACAAACTGGCCTTTGTGGAAGAGAAAGCCCCTGCCCAACAAAACAGC
  TATGACTGTGGGATGTACGTGATATGTAACACTGAGGCCTTGTGTCAGAACTTCTTTAGG
  CAACAGACAGAATCACTGCTGCAGCTACTCACCCCTGCATACATCACAAAGAAGAGGGGA
  GAATGGAAAGATCTCATTACCACACTTGCTAAAAAGTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001172109
• ORF Size: 639 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001172109.1, NP_001165580.1
• RefSeq Size: 1834
• RefSeq ORF: 639
• Locus ID: 123228
• Protein Families: Druggable Genome, Protease
• Gene Summary: This gene encodes a cysteine protease that is a member of the sentrin-specific protease family. The encoded protein is involved in processing and deconjugation of the ubiquitin-like protein termed, neural precursor cell expressed developmentally downregulated 8. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4 and 5 encode the same protein. An in-frame AUG is located 44 codons upstream of the annotated translation start site but is not being annotated as a start site since it is not conserved and is in a weak Kozak sequence context. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.