ITM2A (NM_001171581) Human Untagged Clone

CAT#: SC328350

ITM2A (untagged)-Human integral membrane protein 2A (ITM2A) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ITM2A
• Synonyms: BRICD2A; E25A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001171581, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGAAAATCGCCTTCAATACCCCTACCGCCGTGCAAAAGGAGGAGGCGCGGCAAGACGTGGAGGCCC
  TCCTGAGCCGCACGGTCAGAACTCAGATACTGACCGGCAAGAGCACCATTTACCGTGGAGAGATGTGCTT
  TTTTGATTCTGAGGATCCTGCAAATTCCCTTCGTGGAGGAGAGCCTAACTTCCTGCCTGTGACTGAGGAG
  GCTGACATTCGTGAGGATGACAACATTGCAATCATTGATGTGCCTGTCCCCAGTTTCTCTGATAGTGACC
  CTGCAGCAATTATTCATGACTTTGAAAAGGGAATGACTGCTTACCTGGACTTGTTGCTGGGGAACTGCTA
  TCTGATGCCCCTCAATACTTCTATTGTTATGCCTCCAAAAAATCTGGTAGAGCTCTTTGGCAAACTGGCG
  AGTGGCAGATATCTGCCTCAAACTTATGTGGTTCGAGAAGACCTAGTTGCTGTGGAGGAAATTCGTGATG
  TTAGTAACCTTGGCATCTTTATTTACCAACTTTGCAATAACAGAAAGTCCTTCCGCCTTCGTCGCAGAGA
  CCTCTTGCTGGGTTTCAACAAACGTGCCATTGATAAATGCTGGAAGATTAGACACTTCCCCAACGAATTT
  ATTGTTGAGACCAAGATCTGTCAAGAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001171581
• ORF Size: 660 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001171581.1, NP_001165052.1
• RefSeq Size: 1719
• RefSeq ORF: 660
• Locus ID: 9452
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a type II membrane protein that belongs to the ITM2 family. Studies in mouse suggest that it may be involved in osteo- and chondrogenic differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
  Transcript Variant: This variant (2) is missing an in-frame coding exon compared to variant 1, resulting in a shorter isoform (2) lacking a 44 aa protein segment compared to isoform 1.