RIM1 (RIMS1) (NM_001168411) Human Untagged Clone
CAT#: SC328351
RIMS1 (untagged)-Human regulating synaptic membrane exocytosis 1 (RIMS1) transcript variant 6
"NM_001168411" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RIMS1 |
Synonyms | CORD7; RAB3IP2; RIM; RIM1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001168411, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCTGAAATGAGAAAGATGGTAAGGCAGCCGAGCCGAGAGTCTACTGATGGCAGC ATCAACAGTTACAGCTCTGAGGGCAATTTAATATTTCCTGGAGTGCGACTGGGAGCTGAC AGTCAATTCAGTGATTTTCTTGATGGATTGGGACCAGCCCAGCTTGTTGGCCGCCAAACC CTTGCCACCCCTGCAATGGGTGATATACAAATAGGAATGGAGGACAAAAAGGGCCAATTA GAAGTGGAAGTCATTAGAGCACGAAGCCTCACACAAAAGCCTGGTTCCAAATCTACACCT GCTCCATATGTCAAAGTATATCTTTTGGAAAATGGGGCCTGTATAGCCAAGAAGAAGACA AGAATTGCACGAAAAACCCTTGATCCTTTGTATCAGCAGTCTCTGGTTTTTGATGAAAGT CCACAGGGTAAAGTTCTTCAGGTGATTGTCTGGGGAGACTATGGCAGAATGGACCACAAA TGCTTTATGGGTGTGGCTCAGATCTTGTTGGAAGAACTCGACCTGTCCAGCATGGTGATC GGATGGTACAAATTGTTCCCACCGTCCTCACTGGTGGATCCCACACTCACTCCCCTCACC CGGCGGGCTTCCCAGTCATCTCTGGAAAGTTCAACTGGGCCTCCCTGTATTCGATCATAG |
Restriction Sites | Please inquire |
ACCN | NM_001168411 |
ORF Size | 660 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001168411.1, NP_001161883.1 |
RefSeq Size | 3286 |
RefSeq ORF | 660 |
Locus ID | 22999 |
Gene Summary | The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (6) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (6) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229713 | RIMS1 (Myc-DDK-tagged)-Human regulating synaptic membrane exocytosis 1 (RIMS1), transcript variant 6 |
USD 420.00 |
|
RG229713 | RIMS1 (GFP-tagged) - Human regulating synaptic membrane exocytosis 1 (RIMS1), transcript variant 6 |
USD 460.00 |
|
RC229713L3 | Lenti-ORF clone of RIMS1 (Myc-DDK-tagged)-Human regulating synaptic membrane exocytosis 1 (RIMS1), transcript variant 6 |
USD 620.00 |
|
RC229713L4 | Lenti-ORF clone of RIMS1 (mGFP-tagged)-Human regulating synaptic membrane exocytosis 1 (RIMS1), transcript variant 6 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review