RIM1 (RIMS1) (NM_001168411) Human Untagged Clone

CAT#: SC328351

RIMS1 (untagged)-Human regulating synaptic membrane exocytosis 1 (RIMS1) transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RIMS1
• Synonyms: CORD7; RAB3IP2; RIM; RIM1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001168411, the custom clone sequence may differ by one or more nucleotides
  ATGGCAGCTGAAATGAGAAAGATGGTAAGGCAGCCGAGCCGAGAGTCTACTGATGGCAGC
  ATCAACAGTTACAGCTCTGAGGGCAATTTAATATTTCCTGGAGTGCGACTGGGAGCTGAC
  AGTCAATTCAGTGATTTTCTTGATGGATTGGGACCAGCCCAGCTTGTTGGCCGCCAAACC
  CTTGCCACCCCTGCAATGGGTGATATACAAATAGGAATGGAGGACAAAAAGGGCCAATTA
  GAAGTGGAAGTCATTAGAGCACGAAGCCTCACACAAAAGCCTGGTTCCAAATCTACACCT
  GCTCCATATGTCAAAGTATATCTTTTGGAAAATGGGGCCTGTATAGCCAAGAAGAAGACA
  AGAATTGCACGAAAAACCCTTGATCCTTTGTATCAGCAGTCTCTGGTTTTTGATGAAAGT
  CCACAGGGTAAAGTTCTTCAGGTGATTGTCTGGGGAGACTATGGCAGAATGGACCACAAA
  TGCTTTATGGGTGTGGCTCAGATCTTGTTGGAAGAACTCGACCTGTCCAGCATGGTGATC
  GGATGGTACAAATTGTTCCCACCGTCCTCACTGGTGGATCCCACACTCACTCCCCTCACC
  CGGCGGGCTTCCCAGTCATCTCTGGAAAGTTCAACTGGGCCTCCCTGTATTCGATCATAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001168411
• ORF Size: 660 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001168411.1, NP_001161883.1
• RefSeq Size: 3286
• RefSeq ORF: 660
• Locus ID: 22999
• Gene Summary: The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
  Transcript Variant: This variant (6) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (6) is shorter at the N-terminus compared to isoform 1.