LY108 (SLAMF6) (NM_001184716) Human Untagged Clone
CAT#: SC328353
SLAMF6 (untagged)-Human SLAM family member 6 (SLAMF6) transcript variant 4
"NM_001184716" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SLAMF6 |
Synonyms | CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001184716, the custom clone sequence may differ by one or more nucleotides
ATGTTGTGGCTGTTCCAATCGCTCCTGTTTGTCTTCTGCTTTGGCCCAGGACAACTGAGGAACATACAAG TTACCAATCACAGTCAGCTATTTCAGAATATGACCTGTGAGCTCCATCTGACTTGCTCTGTGGAGGATGC AGATGACAATGTCTCATTCAGATGGGAGGCCTTGGGAAACACACTTTCAAGTCAGCCAAACCTCACTGTC TCCTGGGACCCCAGGATTTCCAGTGAACAGGACTACACCTGCATAGCAGAGAATGCTGTCAGTAATTTAT CCTTCTCTGTCTCTGCCCAGAAGCTTTGCGAAGATGTTAAAATTCAATATACAGATACCAAAATGATTCT GTTTATGGTTTCTGGGATATGCATAGTCTTCGGTTTCATCATACTGCTGTTACTTGTTTTGAGGAAAAGA AGAGATTCCCTATCTTTGTCTACTCAGCGAACACAGGGCCCCGCAGAGTCCGCAAGGAACCTAGAGTATG TTTCAGTGTCTCCAACGAACAACACTGTGTATGCTTCAGTCACTCATTCAAACAGGGAAACAGAAATCTG GACACCTAGAGAAAATGATACTATCACAATTTACTCCACAATTAATCATTCCAAAGAGAGTAAACCCACT TTTTCCAGGGCAACTGCCCTTGACAATGTCGTGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001184716 |
ORF Size | 666 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001184716.1, NP_001171645.1 |
RefSeq Size | 2421 |
RefSeq ORF | 666 |
Locus ID | 114836 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | The protein encoded by this gene is a type I transmembrane protein, belonging to the CD2 subfamily of the immunoglobulin superfamily. This encoded protein is expressed on Natural killer (NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It functions as a coreceptor in the process of NK cell activation. It can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2010] Transcript Variant: This variant (4) lacks an alternate exon in the 5' coding region, compared to variant 1, which result in an isoform (4) with a shorter extracellular domain than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229715 | SLAMF6 (Myc-DDK-tagged)-Human SLAM family member 6 (SLAMF6), transcript variant 4 |
USD 420.00 |
|
RG229715 | SLAMF6 (GFP-tagged) - Human SLAM family member 6 (SLAMF6), transcript variant 4 |
USD 460.00 |
|
RC229715L3 | Lenti ORF clone of Human SLAM family member 6 (SLAMF6), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC229715L4 | Lenti ORF clone of Human SLAM family member 6 (SLAMF6), transcript variant 4, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review