LY108 (SLAMF6) (NM_001184716) Human Untagged Clone

CAT#: SC328353

SLAMF6 (untagged)-Human SLAM family member 6 (SLAMF6) transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLAMF6
• Synonyms: CD352; KALI; KALIb; Ly108; NTB-A; NTBA; SF2000
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001184716, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTGTGGCTGTTCCAATCGCTCCTGTTTGTCTTCTGCTTTGGCCCAGGACAACTGAGGAACATACAAG
  TTACCAATCACAGTCAGCTATTTCAGAATATGACCTGTGAGCTCCATCTGACTTGCTCTGTGGAGGATGC
  AGATGACAATGTCTCATTCAGATGGGAGGCCTTGGGAAACACACTTTCAAGTCAGCCAAACCTCACTGTC
  TCCTGGGACCCCAGGATTTCCAGTGAACAGGACTACACCTGCATAGCAGAGAATGCTGTCAGTAATTTAT
  CCTTCTCTGTCTCTGCCCAGAAGCTTTGCGAAGATGTTAAAATTCAATATACAGATACCAAAATGATTCT
  GTTTATGGTTTCTGGGATATGCATAGTCTTCGGTTTCATCATACTGCTGTTACTTGTTTTGAGGAAAAGA
  AGAGATTCCCTATCTTTGTCTACTCAGCGAACACAGGGCCCCGCAGAGTCCGCAAGGAACCTAGAGTATG
  TTTCAGTGTCTCCAACGAACAACACTGTGTATGCTTCAGTCACTCATTCAAACAGGGAAACAGAAATCTG
  GACACCTAGAGAAAATGATACTATCACAATTTACTCCACAATTAATCATTCCAAAGAGAGTAAACCCACT
  TTTTCCAGGGCAACTGCCCTTGACAATGTCGTGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001184716
• ORF Size: 666 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001184716.1, NP_001171645.1
• RefSeq Size: 2421
• RefSeq ORF: 666
• Locus ID: 114836
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: The protein encoded by this gene is a type I transmembrane protein, belonging to the CD2 subfamily of the immunoglobulin superfamily. This encoded protein is expressed on Natural killer (NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It functions as a coreceptor in the process of NK cell activation. It can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2010]
  Transcript Variant: This variant (4) lacks an alternate exon in the 5' coding region, compared to variant 1, which result in an isoform (4) with a shorter extracellular domain than isoform 1.