Nebulette (NEBL) (NM_001173484) Human Untagged Clone

CAT#: SC328355

NEBL (untagged)-Human nebulette (NEBL) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NEBL
• Synonyms: LASP2; LNEBL
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001173484, the custom clone sequence may differ by one or more nucleotides
  ATGAACCCCCAGTGCGCCCGTTGCGGAAAAGTCGTGTATCCCACCGAGAAAGTCAACTGC
  CTGGATAAGTATTGGCATAAAGGATGTTTCCATTGTGAGGTCTGCAAGATGGCACTCAAC
  ATGAACAACTACAAAGGCTATGAAAAGAAGCCCTATTGTAATGCACACTACCCGAAGCAG
  TCCTTCACCACGGTGGCAGATACACCTGAAAATCTTCGCCTGAAGCAGCAAAGTGAATTG
  CAGAGTCAGGTCAAGTACAAAAGAGATTTTGAAGAAAGCAAAGGGAGGGGCTTCAGCATC
  GTCACGGACACTCCTGAGCTACAGAGACTGAAGAGGACTCAGGAGCAAATCAGTAATGTA
  AAATACCATGAAGATTTTGAAAAAACAAAGGGGAGAGGCTTTACTCCCGTCGTGGACGAT
  CCTGTGACAGAGAGAGTGAGGAAGAACACCCAGGTGGTCAGCGATGCTGCCTATAAAGGG
  GTCCACCCTCACATCGTGGAGATGGACAGGAGACCTGGAATCATTGTTGCACCTGTTCTT
  CCCGGAGCCTATCAGCAAAGCCATTCCCAAGGCTATGGCTACATGCACCAGACCAGTGTG
  TCATCCATGAGATCAATGCAGCATTCACCAAATCTAGACCTACCGAGCCATGTACGATTA
  CAGTGCCCAGGATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001173484
• ORF Size: 675 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001173484.1, NP_001166955.1
• RefSeq Size: 6954
• RefSeq ORF: 675
• Locus ID: 10529
• Gene Summary: This gene encodes a nebulin like protein that is abundantly expressed in cardiac muscle. The encoded protein binds actin and interacts with thin filaments and Z-line associated proteins in striated muscle. This protein may be involved in cardiac myofibril assembly. A shorter isoform of this protein termed LIM nebulette is expressed in non-muscle cells and may function as a component of focal adhesion complexes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
  Transcript Variant: This variant (3) differs in the 5' and 3' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at an alternate start codon and result in a frameshift. The encoded isoform (3) is shorter and has distinct N- and C-termini, compared to isoform 1.