CINP (NM_001177611) Human Untagged Clone
CAT#: SC328359
CINP (untagged)-Human cyclin-dependent kinase 2 interacting protein (CINP) transcript variant 1
"NM_001177611" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CINP |
Synonyms | MGC849 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001177611, the custom clone sequence may differ by one or more nucleotides
ATGAACGGGACGATATACGCAAATGAGTGTCAGCAGATCCGACATCCAAATTCAAAGACT CTTGGAACTGTAACGCCCAGAAAACCTGTCTTATCTGTCAGTGCAAGAAAAATTAAGGAC AATGCGGCTGATTGGCACAATTTAATCCTGAAGTGGGAAACCCTCAATGATGCAGGTTTT ACCACTGCAAATAATATTGCCAACTTGAAAATCAGTTTATTGAATAAAGACAAGATAGAA CTAGACAGCAGCAGCCCAGCCTCGAAGGAAAATGAAGAAAAGGTGTGTCTGGAATATAAC GAGGAACTGGAGAAGCTGTGTGAGGAACTGCAGGCCACCTTGGATGGGTTGACCAAAATA CAGGTGAAAATGGAAAAGCTGTCTTCAACTACCAAGGGAATTTGTGAACTAGAAAACTAC CATTATGGGGAGGAGAGTAAACGACCCCCTCTGTTCCACACGTGGCCTACAACCCATTTC TATGAGGTTTCGCATAAGCTCTTGGAGATGTACAGGAAGGAGCTGCTCCTGAAGCGCACG GTGGCCAAGGAGCTTGCCCACACCGGGGATCCCGACCTCACCCTGAGCTACCTGTCCATG TGGCTGCACCAGCCCTATGTGGAGAGCGACAGCAGGCTGCATCTGGAGAGCATGCTGCTG GAGACAGGCCACCGAGCTCTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001177611 |
ORF Size | 684 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001177611.1, NP_001171082.1 |
RefSeq Size | 1065 |
RefSeq ORF | 684 |
Locus ID | 51550 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene is reported to be a component of the DNA replication complex as well as a genome-maintenance protein. It may interact with proteins important for replication initiation and has been shown to bind chromatin at the G1 phase of the cell cycle and dissociate from chromatin with replication initiation. It may also serve to regulate checkpoint signaling as part of the DNA damage response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229721 | CINP (Myc-DDK-tagged)-Human cyclin-dependent kinase 2 interacting protein (CINP), transcript variant 1 |
USD 420.00 |
|
RG229721 | CINP (GFP-tagged) - Human cyclin-dependent kinase 2 interacting protein (CINP), transcript variant 1 |
USD 460.00 |
|
RC229721L3 | Lenti-ORF clone of CINP (Myc-DDK-tagged)-Human cyclin-dependent kinase 2 interacting protein (CINP), transcript variant 1 |
USD 620.00 |
|
RC229721L4 | Lenti-ORF clone of CINP (mGFP-tagged)-Human cyclin-dependent kinase 2 interacting protein (CINP), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review