VSIG4 (NM_001184831) Human Untagged Clone
CAT#: SC328360
VSIG4 (untagged)-Human V-set and immunoglobulin domain containing 4 (VSIG4) transcript variant 3
"NM_001184831" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | VSIG4 |
Synonyms | CRIg; Z39IG |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001184831, the custom clone sequence may differ by one or more nucleotides
ATGGGGATCTTACTGGGCCTGCTACTCCTGGGGCACCTAACAGTGGACACTTATGGCCGT CCCATCCTGGAAGTGCCAGAGAGTGTAACAGGACCTTGGAAAGGGGATGTGAATCTTCCC TGCACCTATGACCCCCTGCAAGGCTACACCCAAGTCTTGGTGAAGTGGCTGGTACAACGT GGCTCAGACCCTGTCACCATCTTTCTACGTGACTCTTCTGGAGACCATATCCAGCAGGCA AAGTACCAGGGCCGCCTGCATGTGAGCCACAAGGTTCCAGGAGATGTATCCCTCCAATTG AGCACCCTGGAGATGGATGACCGGAGCCACTACACGTGTGAAGTCACCTGGCAGACTCCT GATGGCAACCAAGTCGTGAGAGATAAGATTACTGAGCTCCGTGTCCAGAAACACTCCTCA AAGCTACTCAAGACCAAGACTGAGGCACCTACAACCATGACATACCCCTTGAAAGCAACA TCTACAGTGAAGCAGTCCTGGGACTGGACCACTGACATGGATGGCTACCTTGGAGAGACC AGTGCTGGGCCAGGAAAGAGCCTGCCTGTCTTTGCCATCATCCTCATCATCTCCTTGTGC TGTATGGTGGTTTTTACCATGGCCTATATCATGCTCTGTCGGAAGACATCCCAACAAGAG CATGTCTACGAAGCAGCCAGGTAA |
Restriction Sites | Please inquire |
ACCN | NM_001184831 |
ORF Size | 684 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001184831.1, NP_001171760.1 |
RefSeq Size | 1927 |
RefSeq ORF | 684 |
Locus ID | 11326 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a v-set and immunoglobulin-domain containing protein that is structurally related to the B7 family of immune regulatory proteins. The encoded protein may be a negative regulator of T-cell responses. This protein is also a receptor for the complement component 3 fragments C3b and iC3b. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010] Transcript Variant: This variant (3) has multiple differences, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229722 | VSIG4 (Myc-DDK-tagged)-Human V-set and immunoglobulin domain containing 4 (VSIG4), transcript variant 3 |
USD 420.00 |
|
RG229722 | VSIG4 (GFP-tagged) - Human V-set and immunoglobulin domain containing 4 (VSIG4), transcript variant 3 |
USD 460.00 |
|
RC229722L3 | Lenti-ORF clone of VSIG4 (Myc-DDK-tagged)-Human V-set and immunoglobulin domain containing 4 (VSIG4), transcript variant 3 |
USD 620.00 |
|
RC229722L4 | Lenti-ORF clone of VSIG4 (mGFP-tagged)-Human V-set and immunoglobulin domain containing 4 (VSIG4), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review