FAM3A (NM_001171132) Human Untagged Clone
CAT#: SC328364
FAM3A (untagged)-Human family with sequence similarity 3 member A (FAM3A) transcript variant 2
"NM_001171132" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FAM3A |
Synonyms | 2.19; DLD; DXS560S; XAP-7 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001171132, the custom clone sequence may differ by one or more nucleotides
ATGAGGTTGGCAGGCCCTCTCCGCATTGTGGTCCTAGTCGTCAGTGTGGGTGTCACATGG ATCGTGGTCAGCATCCTCCTGGGTGGGCCTGGCAGTGGCTTTCCTCGCATCCAGCAACTC TTCACCAGTCCAGAGAGCTCGGTGACTGCAGCGCCACGGGCCAGGAAGTACAAGTGTGGC CTGCCCCAGCCGTGTCCTGAGGAGCACCTGGCCTTCCGCGTGGTCAGCGGGGCCGCCAAC GTCATTGGGCCCAAGATCTGCCTCGAGGACAAGATGCTGATGAGCAGCGTCAAGGACAAC GTGGGCCGCGGGCTGAACATCGCCCTGGTGAACGGGGTCAGCGGCGAGCTCATCGAGGCC CGGGCCTTTGACATGTGGGCCGGAGATGTCAACGACCTGTTGAAGTTTATTCGGCCACTG CACGAAGGCACCCTGGTGTTCGTGGCATCCTACGACGACCCAGCCACCAAGATGAATGAA GAGACCAGAAAGCTCTTCAGTGAGCTGGGCAGCAGGAACGCCAAGGAGCTGGCCTTCCGG GACAGCTGGGTGTTTGTCGGGGCCAAGGGTGTGCAGAACAAGAGCCCCTTTGAGCAGCAC GTGAAGAACAGTAAGCACAGCAACAAGTACGAAGGCTGGCCCGAGGCGCTGGAGATGGAA GGCTGTATCCCGCGGAGAAGCACGGCCAGCTAG |
Restriction Sites | Please inquire |
ACCN | NM_001171132 |
ORF Size | 693 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001171132.1, NP_001164603.1 |
RefSeq Size | 2885 |
RefSeq ORF | 693 |
Locus ID | 60343 |
Protein Families | Secreted Protein, Transmembrane |
Gene Summary | This gene encodes a cytokine-like protein. The expression of this gene may be regulated by peroxisome proliferator-activated receptor gamma, and the encoded protein may be involved in the regulation of glucose and lipid metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2 and 6 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229726 | FAM3A (Myc-DDK-tagged)-Human family with sequence similarity 3, member A (FAM3A), transcript variant 2 |
USD 420.00 |
|
RG229726 | FAM3A (GFP-tagged) - Human family with sequence similarity 3, member A (FAM3A), transcript variant 2 |
USD 460.00 |
|
RC229726L3 | Lenti-ORF clone of FAM3A (Myc-DDK-tagged)-Human family with sequence similarity 3, member A (FAM3A), transcript variant 2 |
USD 620.00 |
|
RC229726L4 | Lenti-ORF clone of FAM3A (mGFP-tagged)-Human family with sequence similarity 3, member A (FAM3A), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review