FAM3A (NM_001171132) Human Untagged Clone

CAT#: SC328364

FAM3A (untagged)-Human family with sequence similarity 3 member A (FAM3A) transcript variant 2


  "NM_001171132" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "FAM3A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FAM3A
Synonyms 2.19; DLD; DXS560S; XAP-7
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001171132, the custom clone sequence may differ by one or more nucleotides
ATGAGGTTGGCAGGCCCTCTCCGCATTGTGGTCCTAGTCGTCAGTGTGGGTGTCACATGG
ATCGTGGTCAGCATCCTCCTGGGTGGGCCTGGCAGTGGCTTTCCTCGCATCCAGCAACTC
TTCACCAGTCCAGAGAGCTCGGTGACTGCAGCGCCACGGGCCAGGAAGTACAAGTGTGGC
CTGCCCCAGCCGTGTCCTGAGGAGCACCTGGCCTTCCGCGTGGTCAGCGGGGCCGCCAAC
GTCATTGGGCCCAAGATCTGCCTCGAGGACAAGATGCTGATGAGCAGCGTCAAGGACAAC
GTGGGCCGCGGGCTGAACATCGCCCTGGTGAACGGGGTCAGCGGCGAGCTCATCGAGGCC
CGGGCCTTTGACATGTGGGCCGGAGATGTCAACGACCTGTTGAAGTTTATTCGGCCACTG
CACGAAGGCACCCTGGTGTTCGTGGCATCCTACGACGACCCAGCCACCAAGATGAATGAA
GAGACCAGAAAGCTCTTCAGTGAGCTGGGCAGCAGGAACGCCAAGGAGCTGGCCTTCCGG
GACAGCTGGGTGTTTGTCGGGGCCAAGGGTGTGCAGAACAAGAGCCCCTTTGAGCAGCAC
GTGAAGAACAGTAAGCACAGCAACAAGTACGAAGGCTGGCCCGAGGCGCTGGAGATGGAA
GGCTGTATCCCGCGGAGAAGCACGGCCAGCTAG
Restriction Sites Please inquire     
ACCN NM_001171132
ORF Size 693 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001171132.1, NP_001164603.1
RefSeq Size 2885
RefSeq ORF 693
Locus ID 60343
Protein Families Secreted Protein, Transmembrane
Gene Summary This gene encodes a cytokine-like protein. The expression of this gene may be regulated by peroxisome proliferator-activated receptor gamma, and the encoded protein may be involved in the regulation of glucose and lipid metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2 and 6 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.