Claudin 2 (CLDN2) (NM_001171095) Human Untagged Clone

CAT#: SC328367

CLDN2 (untagged)-Human claudin 2 (CLDN2) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLDN2
• Synonyms: SP82
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001171095, the custom clone sequence may differ by one or more nucleotides
  ATGGCCTCTCTTGGCCTCCAACTTGTGGGCTACATCCTAGGCCTTCTGGGGCTTTTGGGC
  ACACTGGTTGCCATGCTGCTCCCCAGCTGGAAAACAAGTTCTTATGTCGGTGCCAGCATT
  GTGACAGCAGTTGGCTTCTCCAAGGGCCTCTGGATGGAATGTGCCACACACAGCACAGGC
  ATCACCCAGTGTGACATCTATAGCACCCTTCTGGGCCTGCCCGCTGACATCCAGGCTGCC
  CAGGCCATGATGGTGACATCCAGTGCAATCTCCTCCCTGGCCTGCATTATCTCTGTGGTG
  GGCATGAGATGCACAGTCTTCTGCCAGGAATCCCGAGCCAAAGACAGAGTGGCGGTAGCA
  GGTGGAGTCTTTTTCATCCTTGGAGGCCTCCTGGGATTCATTCCTGTTGCCTGGAATCTT
  CATGGGATCCTACGGGACTTCTACTCACCACTGGTGCCTGACAGCATGAAATTTGAGATT
  GGAGAGGCTCTTTACTTGGGCATTATTTCTTCCCTGTTCTCCCTGATAGCTGGAATCATC
  CTCTGCTTTTCCTGCTCATCCCAGAGAAATCGCTCCAACTACTACGATGCCTACCAAGCC
  CAACCTCTTGCCACAAGGAGCTCTCCAAGGCCTGGTCAACCTCCCAAAGTCAAGAGTGAG
  TTCAATTCCTACAGCCTGACAGGGTATGTGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001171095
• ORF Size: 693 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001171095.1, NP_001164566.1
• RefSeq Size: 2932
• RefSeq ORF: 693
• Locus ID: 9075
• Protein Families: Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
• Gene Summary: This gene product belongs to the claudin protein family whose members have been identified as major integral membrane proteins localized exclusively at tight junctions. Claudins are expressed in an organ-specific manner and regulate tissue-specific physiologic properties of tight junctions. This protein is expressed in the intestine. Alternatively spliced transcript variants with different 5' untranslated region have been found for this gene. [provided by RefSeq, Jan 2010]
  Transcript Variant: This variant (3) uses an alternate 5' non-coding exon compared to variant 1. Variants 1-3 encode the same protein.