Interleukin 34 (IL34) (NM_001172771) Human Untagged Clone
CAT#: SC328387
IL34 (untagged)-Human interleukin 34 (IL34) transcript variant 2
"NM_001172771" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IL34 |
Synonyms | C16orf77; IL-34 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001172771, the custom clone sequence may differ by one or more nucleotides
ATGCCCCGGGGCTTCACCTGGCTGCGCTATCTTGGGATCTTCCTTGGCGTGGCCTTGGGGAATGAGCCTT TGGAGATGTGGCCCTTGACGCAGAATGAGGAGTGCACTGTCACGGGTTTTCTGCGGGACAAGCTGCAGTA CAGGAGCCGACTTCAGTACATGAAACACTACTTCCCCATCAACTACAAGATCAGTGTGCCTTACGAGGGG GTGTTCAGAATCGCCAACGTCACCAGGCTGAGGGCCCAGGTGAGCGAGCGGGAGCTGCGGTATCTGTGGG TCTTGGTGAGCCTCAGTGCCACTGAGTCGGTGCAGGACGTGCTGCTCGAGGGCCACCCATCCTGGAAGTA CCTGCAGGAGGTGGAGACGCTGCTGCTGAATGTCCAGCAGGGCCTCACGGATGTGGAGGTCAGCCCCAAG GTGGAATCCGTGTTGTCCCTCTTGAATGCCCCAGGGCCAAACCTGAAGCTGGTGCGGCCCAAAGCCCTGC TGGACAACTGCTTCCGGGTCATGGAGCTGCTGTACTGCTCCTGCTGTAAACAAAGCTCCGTCCTAAACTG GCAGGACTGTGAGGTGCCAAGTCCTCAGTCTTGCAGCCCAGAGCCCTCATTGCAGTATGCGGCCACCCAG CTGTACCCTCCGCCCCCGTGGTCCCCCAGCTCCCCGCCTCACTCCACGGGCTCGGTGAGGCCGGTCAGGG CACAGGGCGAGGGCCTCTTGCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001172771 |
ORF Size | 726 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001172771.1, NP_001166242.1 |
RefSeq Size | 1793 |
RefSeq ORF | 726 |
Locus ID | 146433 |
Gene Summary | Interleukin-34 is a cytokine that promotes the differentiation and viability of monocytes and macrophages through the colony-stimulating factor-1 receptor (CSF1R; MIM 164770) (Lin et al., 2008 [PubMed 18467591]). [supplied by OMIM, May 2008] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1. The resulting isoform (2) lacks one internal amino acid, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229749 | IL34 (Myc-DDK-tagged)-Human interleukin 34 (IL34), transcript variant 2 |
USD 420.00 |
|
RG229749 | IL34 (GFP-tagged) - Human interleukin 34 (IL34), transcript variant 2 |
USD 460.00 |
|
RC229749L3 | Lenti ORF clone of Human interleukin 34 (IL34), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC229749L4 | Lenti ORF clone of Human interleukin 34 (IL34), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review