Interleukin 34 (IL34) (NM_001172771) Human Untagged Clone

CAT#: SC328387

IL34 (untagged)-Human interleukin 34 (IL34) transcript variant 2


  "NM_001172771" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "IL34"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IL34
Synonyms C16orf77; IL-34
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001172771, the custom clone sequence may differ by one or more nucleotides


ATGCCCCGGGGCTTCACCTGGCTGCGCTATCTTGGGATCTTCCTTGGCGTGGCCTTGGGGAATGAGCCTT
TGGAGATGTGGCCCTTGACGCAGAATGAGGAGTGCACTGTCACGGGTTTTCTGCGGGACAAGCTGCAGTA
CAGGAGCCGACTTCAGTACATGAAACACTACTTCCCCATCAACTACAAGATCAGTGTGCCTTACGAGGGG
GTGTTCAGAATCGCCAACGTCACCAGGCTGAGGGCCCAGGTGAGCGAGCGGGAGCTGCGGTATCTGTGGG
TCTTGGTGAGCCTCAGTGCCACTGAGTCGGTGCAGGACGTGCTGCTCGAGGGCCACCCATCCTGGAAGTA
CCTGCAGGAGGTGGAGACGCTGCTGCTGAATGTCCAGCAGGGCCTCACGGATGTGGAGGTCAGCCCCAAG
GTGGAATCCGTGTTGTCCCTCTTGAATGCCCCAGGGCCAAACCTGAAGCTGGTGCGGCCCAAAGCCCTGC
TGGACAACTGCTTCCGGGTCATGGAGCTGCTGTACTGCTCCTGCTGTAAACAAAGCTCCGTCCTAAACTG
GCAGGACTGTGAGGTGCCAAGTCCTCAGTCTTGCAGCCCAGAGCCCTCATTGCAGTATGCGGCCACCCAG
CTGTACCCTCCGCCCCCGTGGTCCCCCAGCTCCCCGCCTCACTCCACGGGCTCGGTGAGGCCGGTCAGGG
CACAGGGCGAGGGCCTCTTGCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001172771
ORF Size 726 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001172771.1, NP_001166242.1
RefSeq Size 1793
RefSeq ORF 726
Locus ID 146433
Gene Summary Interleukin-34 is a cytokine that promotes the differentiation and viability of monocytes and macrophages through the colony-stimulating factor-1 receptor (CSF1R; MIM 164770) (Lin et al., 2008 [PubMed 18467591]). [supplied by OMIM, May 2008]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1. The resulting isoform (2) lacks one internal amino acid, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.