CCRK (CDK20) (NM_001170640) Human Untagged Clone

CAT#: SC328392

CDK20 (untagged)-Human cyclin-dependent kinase 20 (CDK20) transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CDK20
• Synonyms: CCRK; CDCH; P42; PNQALRE
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001170640, the custom clone sequence may differ by one or more nucleotides
  ATGGACCAGTACTGCATCCTGGGCCGCATCGGGGAGGGCGCCCACGGCATCGTCTTCAAG
  GCCAAGCACGTGGAGACTGGCGAGATAGTTGCCCTCAAGAAGGTGGCCCTAAGGCGGTTG
  GAGGACGGCTTCCCTAACCAGGCCCTGCGGGAGATTAAGGCTCTGCAGGAGATGGAGGAC
  AATCAGTATGTGGTACAACTGAAGGCTGTGTTCCCACACGGTGGAGGCTTTGTGCTGGCC
  TTTGAGTTCATGCTGTCGGATCTGGCCGAGGTGGTGCGCCATGCCCAGAGGCCACTAGCC
  CAGGCACAGGTCAAGAGCTACCTGCAGATGCTGCTCAAGGGTGTCGCCTTCTGCCATGCC
  AACAACATTGTACATCGGGACCTGAAACCTGCCAACCTGCTCATCAGCGCCTCAGGCCAG
  CTCAAGATAGCGGACTTTGGCCTGGCTCGAGTCTTTTCCCCAGACGGCAGCCGCCTCTAC
  ACACACCAGGTGGCCACCAGGAGCTCACTGAGCTGCCGGACTACAACAAGATCTCCTTTA
  AGGAGCAGGTGCCCATGCCCCTGGAGGAGGTGCTGCCTGACGTCTCTCCCCAGGCATTGG
  ATCTGCTGGGTCAATTCCTTCTCTACCCTCCTCACCAGCGCATCGCAGCTTCCAAGGCTC
  TCCTCCATCAGTACTTCTTCACAGCTCCCCTGCCTGCCCATCCATCTGAGCTGCCGATTC
  CTCAGCGTCTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001170640
• ORF Size: 732 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001170640.1, NP_001164111.1
• RefSeq Size: 2219
• RefSeq ORF: 732
• Locus ID: 23552
• Protein Families: Druggable Genome, Protein Kinase
• Gene Summary: The protein encoded by this gene contains a kinase domain most closely related to the cyclin-dependent protein kinases. The encoded kinase may activate cyclin-dependent kinase 2 and is involved in cell growth. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Dec 2009]
  Transcript Variant: This variant (5) uses an alternate in-frame splice site in the 5' coding region, and lacks an exon in the 3' coding region, which results in a frameshift compared to variant 1. This results in a shorter protein (isoform 5, also known as cardiac CCRK), compared to isoform 1.