BEAN1 (NM_001178020) Human Untagged Clone

CAT#: SC328419

BEAN1 (untagged)-Human brain expressed associated with Nedd4 (BEAN) transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BEAN1
• Synonyms: BEAN; SCA31
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001178020, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCTTCAAACGTCCCTGCCCCTTAGCACGATACAACCGCACCAGCTACTTCTACCCCACATTCTCAG
  AGAGCTCGGAGCACAGCCATCTGCTCGTGTCCCCCGTGCTGGTGGCGAGTGCCGTCATAGGTGTGGTCAT
  CATCCTCTCCTGCATCACCATCATTGTGGGCAGCATCCGCAGGGACAGGCAGGCCCGGCTTCAGCGGCAC
  CGCCACCGCCACCACCGCCACCACCACCACCATCATCACCACCGCCGGCGTCGACACCGAGAGTACGAGC
  ACGGCTACGTGTCGGACGAGCACACATACAGCCGCTCAAGCCGCAGGATGCGCTATGCCTGCAGCTCCTC
  AGAGGACTGGCCCCCACCCTTGGACATCAGCTCTGACGGGGACGTGGATGCCACGGTGCTCAGGGAGCTG
  TACCCAGATTCTCCACCAGGCTACGAGGAGTGTGTGGGGCCAGGGGCCACTCAGCTGTATGTCCCCACGG
  ACGCACCACCACCCTACTCGCTGACTGATTCCTGCCCCACGCTGGATGGCACCTCCGACTCAGGCAGCGG
  CCACAGCCCTGGCCGACACCAGCAGGAGCAGAGGACCCCGGCCCAAGGTGGCCTTCACACGGTCTCCATG
  GACACCCTTCCCCCCTACGAGGCTGTGTGCGGGGCTGGCCCCCCATCAGGCCTGCTGCCACTGCCGGGCC
  CAGACCCAGGGCCAAGGGGCTCCCAGGGCTCACCCACCCCAACCCGGGCCCCAGCCTCTGGCCCAGAGAG
  GATTGTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001178020
• ORF Size: 780 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001178020.2, NP_001171491.1
• RefSeq Size: 2931
• RefSeq ORF: 780
• Locus ID: 146227
• Protein Families: Transmembrane
• Gene Summary: The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).