SCO2 (NM_001169109) Human Untagged Clone
CAT#: SC328431
SCO2 (untagged)-Human SCO cytochrome oxidase deficient homolog 2 (yeast) (SCO2) nuclear gene encoding mitochondrial protein transcript variant 2
"NM_001169109" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SCO2 |
Synonyms | CEMCOX1; ECGF1; Gliostatin; MYP6; PD-ECGF; SCO1L; TdRPase; TP; TYMP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001169109, the custom clone sequence may differ by one or more nucleotides
ATGCTGCTGCTGACTCGGAGCCCCACAGCTTGGCACAGGCTCTCTCAGCTCAAGCCTCGGGTCCTCCCTG GGACCCTGGGAGGCCAGGCCCTGCATCTGAGGTCCTGGCTTTTGTCAAGGCAGGGCCCTGCAGAGACAGG TGGGCAGGGCCAGCCCCAGGGCCCTGGGCTTCGAACCCGGCTGCTGATCACAGGCCTGTTCGGGGCTGGA CTCGGTGGGGCCTGGCTGGCCCTGAGGGCTGAGAAGGAGAGGCTGCAGCAGCAAAAGCGAACAGAAGCCC TGCGCCAGGCAGCTGTGGGCCAGGGCGACTTCCACCTGCTGGATCACAGAGGCCGGGCTCGCTGCAAGGC TGACTTCCGGGGCCAGTGGGTGCTGATGTACTTTGGCTTCACTCACTGCCCTGACATCTGCCCAGACGAG CTGGAGAAGCTGGTGCAGGTGGTGCGGCAGCTGGAAGCAGAGCCTGGTTTGCCTCCAGTGCAGCCTGTCT TCATCACTGTGGACCCCGAGCGGGACGACGTTGAAGCCATGGCCCGCTACGTCCAGGACTTCCACCCAAG ACTGTTGGGTCTGACCGGCTCCACCAAACAGGTTGCCCAGGCTAGTCACAGTTACCGCGTGTACTACAAT GCAGGCCCCAAGGATGAGGACCAGGACTACATCGTGGACCACTCCATTGCCATCTACCTGCTCAACCCTG ACGGCCTCTTCACGGATTACTACGGCCGGAGCAGATCGGCTGAGCAGATCTCAGACAGTGTGCGGCGGCA CATGGCGGCTTTCCGCAGTGTCCTGTCTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001169109 |
ORF Size | 801 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001169109.1, NP_001162580.1 |
RefSeq Size | 1051 |
RefSeq ORF | 801 |
Locus ID | 9997 |
Protein Families | Druggable Genome |
Gene Summary | Cytochrome c oxidase (COX) catalyzes the transfer of electrons from cytochrome c to molecular oxygen, which helps to maintain the proton gradient across the inner mitochondrial membrane that is necessary for aerobic ATP production. Human COX is a multimeric protein complex that requires several assembly factors; this gene encodes one of the COX assembly factors. The encoded protein is a metallochaperone that is involved in the biogenesis of cytochrome c oxidase subunit II. Mutations in this gene are associated with fatal infantile encephalocardiomyopathy and myopia 6. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3 and 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229793 | SCO2 (Myc-DDK-tagged)-Human SCO cytochrome oxidase deficient homolog 2 (yeast) (SCO2), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 420.00 |
|
RG229793 | SCO2 (GFP-tagged) - Human SCO cytochrome oxidase deficient homolog 2 (yeast) (SCO2), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 460.00 |
|
RC229793L3 | Lenti ORF clone of Human SCO cytochrome oxidase deficient homolog 2 (yeast) (SCO2), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC229793L4 | Lenti ORF clone of Human SCO cytochrome oxidase deficient homolog 2 (yeast) (SCO2), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review