SCO2 (NM_001169111) Human Untagged Clone

CAT#: SC328433

SCO2 (untagged)-Human SCO cytochrome oxidase deficient homolog 2 (yeast) (SCO2) nuclear gene encoding mitochondrial protein transcript variant 4


  "NM_001169111" in other vectors (4)

Reconstitution Protocol

USD 660.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SCO2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SCO2
Synonyms CEMCOX1; ECGF1; Gliostatin; MYP6; PD-ECGF; SCO1L; TdRPase; TP; TYMP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001169111, the custom clone sequence may differ by one or more nucleotides
ATGCTGCTGCTGACTCGGAGCCCCACAGCTTGGCACAGGCTCTCTCAGCTCAAGCCTCGG
GTCCTCCCTGGGACCCTGGGAGGCCAGGCCCTGCATCTGAGGTCCTGGCTTTTGTCAAGG
CAGGGCCCTGCAGAGACAGGTGGGCAGGGCCAGCCCCAGGGCCCTGGGCTTCGAACCCGG
CTGCTGATCACAGGCCTGTTCGGGGCTGGACTCGGTGGGGCCTGGCTGGCCCTGAGGGCT
GAGAAGGAGAGGCTGCAGCAGCAAAAGCGAACAGAAGCCCTGCGCCAGGCAGCTGTGGGC
CAGGGCGACTTCCACCTGCTGGATCACAGAGGCCGGGCTCGCTGCAAGGCTGACTTCCGG
GGCCAGTGGGTGCTGATGTACTTTGGCTTCACTCACTGCCCTGACATCTGCCCAGACGAG
CTGGAGAAGCTGGTGCAGGTGGTGCGGCAGCTGGAAGCAGAGCCTGGTTTGCCTCCAGTG
CAGCCTGTCTTCATCACTGTGGACCCCGAGCGGGACGACGTTGAAGCCATGGCCCGCTAC
GTCCAGGACTTCCACCCAAGACTGTTGGGTCTGACCGGCTCCACCAAACAGGTTGCCCAG
GCTAGTCACAGTTACCGCGTGTACTACAATGCAGGCCCCAAGGATGAGGACCAGGACTAC
ATCGTGGACCACTCCATTGCCATCTACCTGCTCAACCCTGACGGCCTCTTCACGGATTAC
TACGGCCGGAGCAGATCGGCTGAGCAGATCTCAGACAGTGTGCGGCGGCACATGGCGGCT
TTCCGCAGTGTCCTGTCTTGA
Restriction Sites Please inquire     
ACCN NM_001169111
ORF Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001169111.1, NP_001162582.1
RefSeq Size 1020
RefSeq ORF 801
Locus ID 9997
Protein Families Druggable Genome
Gene Summary Cytochrome c oxidase (COX) catalyzes the transfer of electrons from cytochrome c to molecular oxygen, which helps to maintain the proton gradient across the inner mitochondrial membrane that is necessary for aerobic ATP production. Human COX is a multimeric protein complex that requires several assembly factors; this gene encodes one of the COX assembly factors. The encoded protein is a metallochaperone that is involved in the biogenesis of cytochrome c oxidase subunit II. Mutations in this gene are associated with fatal infantile encephalocardiomyopathy and myopia 6. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3 and 4 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.