CD244 (NM_001166664) Human Untagged Clone

CAT#: SC328444

CD244 (untagged)-Human CD244 molecule natural killer cell receptor 2B4 (CD244) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD244
• Synonyms: 2B4; NAIL; NKR2B4; Nmrk; SLAMF4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001166664, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGGGGCAAGTGGTCACCCTCATACTCCTCCTGCTCCTCAAGGTGTATCAGGGCAAAGGATGCCAGG
  GATCAGCTGACCATGTGGTTAGCATCTCGGGAGTGCCTCTTCAGTTACAACCAAACAGCATACAGACGAA
  GGTTGACAGCATTGCATGGAAGAAGTTGCTGCCCTCACAAAATGGATTTCATCACATATTGAAGTGGGAG
  AATGGCTCTTTGCCTTCCAATACTTCCAATGATAGATTCAGTTTTATAGTCAAGAACTTGAGTCTTCTCA
  TCAAGGCAGCTCAGCAGCAGGACAGTGGCCTCTACTGCCTGGAGGTCACCAGTATATCTGGAAAAGTTCA
  GACAGCCACGTTCCAGGTTTTTGTATTTGAATTCAGATTTTGGCCGTTTTTGGTGATCATCGTGATTCTA
  AGCGCACTGTTCCTTGGCACCCTTGCCTGCTTCTGTGTGTGGAGGAGAAAGAGGAAGGAGAAGCAGTCAG
  AGACCAGTCCCAAGGAATTTTTGACAATTTACGAAGATGTCAAGGATCTGAAAACCAGGAGAAATCACGA
  GCAGGAGCAGACTTTTCCTGGAGGGGGGAGCACCATCTACTCTATGATCCAGTCCCAGTCTTCTGCTCCC
  ACGTCACAAGAACCTGCATATACATTATATTCATTAATTCAGCCTTCCAGGAAGTCTGGATCCAGGAAGA
  GGAACCACAGCCCTTCCTTCAATAGCACTATCTATGAAGTGATTGGAAAGAGTCAACCTAAAGCCCAGAA
  CCCTGCTCGATTGAGCCGCAAAGAGCTGGAGAACTTTGATGTTTATTCCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001166664
• ORF Size: 822 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001166664.1, NP_001160136.1
• RefSeq Size: 2252
• RefSeq ORF: 822
• Locus ID: 51744
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
• Protein Pathways: Natural killer cell mediated cytotoxicity
• Gene Summary: This gene encodes a cell surface receptor expressed on natural killer (NK) cells (and some T cells) that mediate non-major histocompatibility complex (MHC) restricted killing. The interaction between NK-cell and target cells via this receptor is thought to modulate NK-cell cytolytic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
  Transcript Variant: This variant (3) is lacking an in-frame coding exon compared to variant 1, resulting in a shorter isoform (3) missing an internal protein segment compared to isoform 1.