SLC25A21 (NM_001171170) Human Untagged Clone
CAT#: SC328484
SLC25A21 (untagged)-Human solute carrier family 25 (mitochondrial oxodicarboxylate carrier) member 21 (SLC25A21) nuclear gene encoding mitochondrial protein transcript variant 2
"NM_001171170" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SLC25A21 |
Synonyms | ODC; ODC1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001171170, the custom clone sequence may differ by one or more nucleotides
ATGTCCGCCAAGCCTGAAGTCAGCTTAGTGCGCGAGGCTTCTCGGCAGATCGTGGCCGGTGGTTCTGCAG GTCTTGTAGAAATTTGCCTGATGCACCCCCTAGATGTGGTGAAAACCAGGTTTCAGATTCAGAGATGTGC AACCGATCCAAACAGTTATAAAAGCTTGGTAGACAGCTTTCGAATGATTTTCCAAATGGAAGGGTTATTT GGTTTTTACAAGGGAATTCTGCCACCTATCTTGGCTGAAACCCCAAAAAGAGCAGTGAAGTTTTTCACCT TTGAGCAGTACAAGAAATTGCTGGGATATGTGTCACTGTCACCAGCATTGACATTCGCCATTGCTGGATT GGGATCTGGACTAACAGAAGCCATTGTAGTTAACCCTTTTGAGGTAGTAAAAGTTGGCTTGCAAGCAAAT CGGAACACATTTGCAGAGCAACCATCCACTGTGGGTTATGCAAGACAAATCATTAAGAAGGAAGGCTGGG GACTCCAGGGCCTCAACAAAGGATTAACTGCAACTTTGGGACGACATGGAGTTTTCAACATGGTTTATTT TGGCTTCTACTACAATGTCAAAAACATGATTCCTGTCAATAAGGATCCAATCTTGGAGTTTTGGAGAAAA TTTGGGATTGGTCTTCTCTCGGGGACAATAGCCTCAGTCATTAACATCCCTTTTGATGTTGCCAAAAGTA GGATTCAAGGGCCTCAACCAGTTCCTGGAGAGATCAAGTACAGAACCTGTTTTAAAACAATGGCAACAGT CTATCAGGAAGAAGGGATTTTAGCTTTGTACAAAGGCCTGCTTCCCAAGATTATGAGACTTGGACCAGGT GGTGCAGTGATGCTGCTGGTTTATGAATACACCTATTCATGGCTTCAAGAGAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001171170 |
ORF Size | 897 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001171170.1, NP_001164641.1 |
RefSeq Size | 1770 |
RefSeq ORF | 897 |
Locus ID | 89874 |
Gene Summary | SLC25A21 is a homolog of the S. cerevisiae ODC proteins, mitochondrial carriers that transport C5-C7 oxodicarboxylates across inner mitochondrial membranes. One of the species transported by ODC is 2-oxoadipate, a common intermediate in the catabolism of lysine, tryptophan, and hydroxylysine in mammals. Within mitochondria, 2-oxoadipate is converted into acetyl-CoA. [supplied by OMIM, Apr 2004] Transcript Variant: This variant (2) has a split 3' exon, as compared to variant 1. The resulting isoform (2) lacks the last aa, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229846 | SLC25A21 (Myc-DDK-tagged)-Human solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 (SLC25A21), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 420.00 |
|
RG229846 | SLC25A21 (GFP-tagged) - Human solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 (SLC25A21), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 460.00 |
|
RC229846L3 | Lenti-ORF clone of SLC25A21 (Myc-DDK-tagged)-Human solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 (SLC25A21), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 620.00 |
|
RC229846L4 | Lenti-ORF clone of SLC25A21 (mGFP-tagged)-Human solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 (SLC25A21), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review