p53R2 (RRM2B) (NM_001172478) Human Untagged Clone
CAT#: SC328486
RRM2B (untagged)-Human ribonucleotide reductase M2 B (TP53 inducible) (RRM2B) transcript variant 3
"NM_001172478" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RRM2B |
Synonyms | MTDPS8A; MTDPS8B; P53R2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001172478, the custom clone sequence may differ by one or more nucleotides
ATGGGCGACCCGGAAAGGCCGGAAGCGGCCGGGCTGGATCAGGATGAGGTCGACTTATCAAAGGATCTCC CTCACTGGAACAAGCTTAAAGCAGATGAGAAGTACTTCATCTCTCACATCTTAGCCTTTTTTGCAGCCAG TGATGGAATTGTAAATGAAAATTTGGTGGAGCGCTTTAGTCAGGAGGTGCAGGTTCCAGAGGCTCGCTGT TTCTATGGCTTTCAAATTCTCATCGAGAATGTTCACTCAGAGATGTACAGTTTGCTGATAGACACTTACA TCAGAGATCCCAAGAAAAGGGAATTTTTATTTAATGCAATTGAAACCATGCCCTATGTTAAGAAAAAAGC AGATTGGGCCTTGCGATGGATAGCAGATAGAAAATCTACTTTTGGGGAAAGAGTGGTGGCCTTTGCTGCT GTAGAAGGAGTTTTCTTCTCAGGATCTTTTGCTGCTATATTCTGGCTAAAGAAGAGAGGTCTTATGCCAG GACTCACTTTTTCCAATGAACTCATCAGCAGAGATGAAGGACTTCACTGTGACTTTGCTTGCCTGATGTT CCAATACTTAGTAAATAAGCCTTCAGAAGAAAGGGTCAGGGAGATCATTGTTGATGCTGTCAAAATTGAG CAGGAGTTTTTAACAGAAGCCTTGCCAGTTGGCCTCATTGGAATGAATTGCATTTTGATGAAACAGTACA TTGAGTTTGTAGCTGACAGATTACTTGTGGAACTTGGATTCTCAAAGGTTTTTCAGGCAGAAAATCCTTT TGATTTTATGGAAAACATTTCTTTAGAAGGAAAAACAAATTTCTTTGAGAAACGAGTTTCAGAGTATCAG CGTTTTGCAGTTATGGCAGAAACCACAGATAACGTCTTCACCTTGGATGCAGATTTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001172478 |
ORF Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001172478.1, NP_001165949.1 |
RefSeq Size | 4776 |
RefSeq ORF | 900 |
Locus ID | 50484 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Glutathione metabolism, Metabolic pathways, p53 signaling pathway, Purine metabolism, Pyrimidine metabolism |
Gene Summary | This gene encodes the small subunit of a p53-inducible ribonucleotide reductase. This heterotetrameric enzyme catalyzes the conversion of ribonucleoside diphosphates to deoxyribonucleoside diphosphates. The product of this reaction is necessary for DNA synthesis. Mutations in this gene have been associated with autosomal recessive mitochondrial DNA depletion syndrome, autosomal dominant progressive external ophthalmoplegia-5, and mitochondrial neurogastrointestinal encephalopathy. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010] Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229848 | RRM2B (Myc-DDK-tagged)-Human ribonucleotide reductase M2 B (TP53 inducible) (RRM2B), transcript variant 3 |
USD 420.00 |
|
RG229848 | RRM2B (GFP-tagged) - Human ribonucleotide reductase M2 B (TP53 inducible) (RRM2B), transcript variant 3 |
USD 460.00 |
|
RC229848L3 | Lenti ORF clone of Human ribonucleotide reductase M2 B (TP53 inducible) (RRM2B), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC229848L4 | Lenti ORF clone of Human ribonucleotide reductase M2 B (TP53 inducible) (RRM2B), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review