p53R2 (RRM2B) (NM_001172478) Human Untagged Clone

CAT#: SC328486

RRM2B (untagged)-Human ribonucleotide reductase M2 B (TP53 inducible) (RRM2B) transcript variant 3


  "NM_001172478" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RRM2B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RRM2B
Synonyms MTDPS8A; MTDPS8B; P53R2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001172478, the custom clone sequence may differ by one or more nucleotides


ATGGGCGACCCGGAAAGGCCGGAAGCGGCCGGGCTGGATCAGGATGAGGTCGACTTATCAAAGGATCTCC
CTCACTGGAACAAGCTTAAAGCAGATGAGAAGTACTTCATCTCTCACATCTTAGCCTTTTTTGCAGCCAG
TGATGGAATTGTAAATGAAAATTTGGTGGAGCGCTTTAGTCAGGAGGTGCAGGTTCCAGAGGCTCGCTGT
TTCTATGGCTTTCAAATTCTCATCGAGAATGTTCACTCAGAGATGTACAGTTTGCTGATAGACACTTACA
TCAGAGATCCCAAGAAAAGGGAATTTTTATTTAATGCAATTGAAACCATGCCCTATGTTAAGAAAAAAGC
AGATTGGGCCTTGCGATGGATAGCAGATAGAAAATCTACTTTTGGGGAAAGAGTGGTGGCCTTTGCTGCT
GTAGAAGGAGTTTTCTTCTCAGGATCTTTTGCTGCTATATTCTGGCTAAAGAAGAGAGGTCTTATGCCAG
GACTCACTTTTTCCAATGAACTCATCAGCAGAGATGAAGGACTTCACTGTGACTTTGCTTGCCTGATGTT
CCAATACTTAGTAAATAAGCCTTCAGAAGAAAGGGTCAGGGAGATCATTGTTGATGCTGTCAAAATTGAG
CAGGAGTTTTTAACAGAAGCCTTGCCAGTTGGCCTCATTGGAATGAATTGCATTTTGATGAAACAGTACA
TTGAGTTTGTAGCTGACAGATTACTTGTGGAACTTGGATTCTCAAAGGTTTTTCAGGCAGAAAATCCTTT
TGATTTTATGGAAAACATTTCTTTAGAAGGAAAAACAAATTTCTTTGAGAAACGAGTTTCAGAGTATCAG
CGTTTTGCAGTTATGGCAGAAACCACAGATAACGTCTTCACCTTGGATGCAGATTTTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001172478
ORF Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001172478.1, NP_001165949.1
RefSeq Size 4776
RefSeq ORF 900
Locus ID 50484
Protein Families Druggable Genome, Transmembrane
Protein Pathways Glutathione metabolism, Metabolic pathways, p53 signaling pathway, Purine metabolism, Pyrimidine metabolism
Gene Summary This gene encodes the small subunit of a p53-inducible ribonucleotide reductase. This heterotetrameric enzyme catalyzes the conversion of ribonucleoside diphosphates to deoxyribonucleoside diphosphates. The product of this reaction is necessary for DNA synthesis. Mutations in this gene have been associated with autosomal recessive mitochondrial DNA depletion syndrome, autosomal dominant progressive external ophthalmoplegia-5, and mitochondrial neurogastrointestinal encephalopathy. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.