Manic Fringe (MFNG) (NM_001166343) Human Untagged Clone

CAT#: SC328498

MFNG (untagged)-Human MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase (MFNG) transcript variant 2


  "NM_001166343" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MFNG"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MFNG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001166343, the custom clone sequence may differ by one or more nucleotides


ATGCAGTGCCGGCTCCCGCGGGGCCTGGCTGGAGCCCTCCTCACCCTCCTGTGCATGGGGCTCCTGTGTC
TGCGGTACCACTTGAACCTGTCCCCGCAGCGGGTACAAGGGACCCCCGAGCTGAGCCAGCCGAACCCGGG
GCCCCCTAAGCTACAGCTACACGATGTCTTCATTGCAGTGAAGACGACCCGGGCTTTCCACCGCTTGCGC
CTGGAGCTGCTGCTTGACACGTGGGTTTCCAGGACCAGGGAACAGGTGACAAGGTCCCACCTTGTGGTCA
CCAACTGCTCCGCGGAACACAGCCACCCAGCTCTGTCCTGCAAGATGGCTGCTGAGTTCGACACCTTCTT
GGCCAGTGGGCTTAGGTGGTTCTGCCATGTGGACGATGACAACTATGTGAACCCAAGGGCGCTGCTGCAG
CTTCTGAGAGCCTTCCCGCTGGCCCGCGACGTCTATGTGGGAAGGCCCAGCCTGAACCGGCCCATCCATG
CCTCAGAGCCACAGCCCCACAACCGCACGAGGCTGGTACAGTTCTGGTTTGCCACTGGGGGTGCTGGCTT
CTGCATCAATCGCAAACTGGCTTTGAAGATGGCTCCGTGGGCCAGTGGCTCCCGTTTCATGGACACATCT
GCTCTCATCCGGCTGCCTGATGACTGCACCATGGGCTATATCATTGAGTGCAAGCTGGGCGGCCGCCTGC
AGCCCAGCCCCCTCTTTCACTCCCACCTGGAGACCCTGCAGCTGCTGAGGACTGCACAGCTCCCAGAACA
GGTCACCCTCAGCTACGGTGTCTTTGAGGGGAAACTCAACGTCATTAAGCTACAGGGCCCCTTCTCCCCG
GAGGAGGACCCCTCCAGATTTCGCTCCCTCCATTGTCTGCTCTATCCAGATACACCCTGGTGTCCCCAGC
TGGGTGCCCGATGA


Restriction Sites SgfI-MluI     
ACCN NM_001166343
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001166343.1, NP_001159815.1
RefSeq Size 2034 bp
RefSeq ORF 924 bp
Locus ID 4242
Cytogenetics 22q13.1
Protein Families Druggable Genome
Protein Pathways Notch signaling pathway
Gene Summary 'This gene is a member of the glycosyltransferase 31 gene family. Members of this gene family, which also includes the LFNG (GeneID: 3955) and RFNG (GeneID: 5986) genes, encode evolutionarily conserved glycosyltransferases that act in the Notch signaling pathway to define boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, these proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. The protein encoded by this gene may control Notch signaling in claudin-low breast cancer. [provided by RefSeq, May 2018]'
Transcript Variant: This variant (2) uses an alternate splice site in the 5' exon and lacks an alternate 5' coding exon, compared to variant 1, resulting in a protein that maintains the reading frame but is shorter, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.