MAGEA12 (NM_001166387) Human Untagged Clone

CAT#: SC328505

MAGEA12 (untagged)-Human melanoma antigen family A 12 (MAGEA12) transcript variant 2


  "NM_001166387" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAGEA12"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAGEA12
Synonyms CT1.12; MAGE12
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001166387, the custom clone sequence may differ by one or more nucleotides


ATGCCACTTGAGCAGAGGAGTCAGCACTGCAAGCCTGAGGAAGGCCTTGAGGCCCAAGGAGAGGCCCTGG
GCTTGGTGGGTGCGCAGGCTCCTGCTACTGAGGAGCAGGAGACTGCCTCCTCCTCCTCTACTCTAGTGGA
AGTCACCCTGCGGGAGGTGCCTGCTGCCGAGTCACCAAGTCCTCCCCACAGTCCTCAGGGAGCCTCCACC
CTCCCCACTACCATCAACTATACTCTCTGGAGTCAATCCGATGAGGGCTCCAGCAACGAAGAACAGGAAG
GGCCAAGCACCTTTCCTGACCTGGAGACGAGCTTCCAAGTAGCACTCAGTAGGAAGATGGCTGAGTTGGT
TCATTTTCTGCTCCTCAAGTATCGAGCCAGGGAGCCATTCACAAAGGCAGAAATGCTGGGGAGTGTCATC
AGAAATTTCCAGGACTTCTTTCCTGTGATCTTCAGCAAAGCCTCCGAGTACTTGCAGCTGGTCTTTGGCA
TCGAGGTGGTGGAAGTGGTCCGCATCGGCCACTTGTACATCCTTGTCACCTGCCTGGGCCTCTCCTACGA
TGGCCTGCTGGGCGACAATCAGATCGTGCCCAAGACAGGCCTCCTGATAATCGTCCTGGCCATAATCGCA
AAAGAGGGCGACTGTGCCCCTGAGGAGAAAATCTGGGAGGAGCTGAGTGTGTTGGAGGCATCTGATGGGA
GGGAGGACAGTGTCTTTGCGCATCCCAGGAAGCTGCTCACCCAAGATTTGGTGCAGGAAAACTACCTGGA
GTACCGGCAGGTCCCCGGCAGTGATCCTGCATGCTACGAGTTCCTGTGGGGTCCAAGGGCCCTCGTTGAA
ACCAGCTATGTGAAAGTCCTGCACCATTTGCTAAAGATCAGTGGAGGACCTCACATTTCCTACCCACCCC
TGCATGAATGGGCTTTTAGAGAGGGGGAAGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001166387
ORF Size 945 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001166387.3, NP_001159859.1
RefSeq Size 1770
RefSeq ORF 945
Locus ID 4111
Gene Summary This gene is closely related to several other genes clustered on chromosome X. These genes may be overexpressed in tumors. Multiple alternatively spliced variants encoding the same protein have been identified. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 all encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.